ID: 1027524114

View in Genome Browser
Species Human (GRCh38)
Location 7:79245490-79245512
Sequence GGCAGTACTCTCTACAAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027524111_1027524114 3 Left 1027524111 7:79245464-79245486 CCTTGAATGAACATTGGCAGTAG 0: 4
1: 27
2: 161
3: 361
4: 715
Right 1027524114 7:79245490-79245512 GGCAGTACTCTCTACAAGTTCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1027524109_1027524114 10 Left 1027524109 7:79245457-79245479 CCTTGGTCCTTGAATGAACATTG 0: 1
1: 6
2: 59
3: 204
4: 599
Right 1027524114 7:79245490-79245512 GGCAGTACTCTCTACAAGTTCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1027524108_1027524114 11 Left 1027524108 7:79245456-79245478 CCCTTGGTCCTTGAATGAACATT 0: 2
1: 11
2: 73
3: 243
4: 669
Right 1027524114 7:79245490-79245512 GGCAGTACTCTCTACAAGTTCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1027524106_1027524114 30 Left 1027524106 7:79245437-79245459 CCAGAAGCTGACGGAAGGGCCCT 0: 1
1: 0
2: 15
3: 167
4: 462
Right 1027524114 7:79245490-79245512 GGCAGTACTCTCTACAAGTTCGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027524114 Original CRISPR GGCAGTACTCTCTACAAGTT CGG Intronic
900866518 1:5272737-5272759 GGCTGCATTCTCTAAAAGTTTGG - Intergenic
905535283 1:38716380-38716402 GCCAGTACTCTCTGCCAGTGTGG + Intergenic
909111309 1:71481390-71481412 GGCAGTACTCTAAACAATTTAGG - Intronic
910886842 1:91972800-91972822 GTCACTACTCTCTAAAACTTAGG - Intronic
910902678 1:92138720-92138742 AGCAGTGCTCTCAACAAGATGGG + Intronic
912903745 1:113681060-113681082 GGCAGTACTGGGTACACGTTAGG + Intronic
917318638 1:173756022-173756044 GGAAGTACTCTTTGCAGGTTTGG + Exonic
921871736 1:220147668-220147690 GACAGTACTGGCTAGAAGTTTGG + Exonic
922152641 1:223018667-223018689 GGCAGTTCTCTCTACATCCTCGG - Intergenic
922798304 1:228352385-228352407 GTCAGTAATCTCAACAATTTGGG + Intronic
1066482566 10:35811318-35811340 GGCAGTCCTGTCTAGAACTTTGG - Intergenic
1067220934 10:44343907-44343929 GGCAGTTCTCTCTACTACTCAGG + Intergenic
1068447972 10:57147212-57147234 GGCAGTACTCACCGCAGGTTAGG + Intergenic
1068752441 10:60610614-60610636 GACAGTGATCTCTTCAAGTTTGG - Intronic
1084763807 11:71294457-71294479 GGCAGTACTCACCACAAGGCTGG - Intergenic
1090447396 11:126775977-126775999 GACAGTACTTTCTGCAAGCTGGG + Intronic
1093403417 12:18776234-18776256 GGCAGCACTCTCTCCCAGTTGGG + Intergenic
1094697594 12:32835902-32835924 GCCAGTAGTCTCAACAACTTGGG - Intronic
1096674365 12:53218699-53218721 AGCAGTGCTGTTTACAAGTTCGG - Intronic
1096690859 12:53321061-53321083 GGGAGAACTATCTAAAAGTTGGG - Intronic
1110448737 13:75617684-75617706 GGCAGTACTCACTATAGGCTTGG - Intergenic
1111072932 13:83193296-83193318 AGCAGTTCTCTTTCCAAGTTGGG - Intergenic
1114150473 14:20032717-20032739 AGCAGTACAATGTACAAGTTGGG + Intergenic
1117568572 14:57022204-57022226 GTAAGTACTCTCTACAGGATAGG + Intergenic
1119146542 14:72320125-72320147 GGCATTACTCTCTGCAATCTTGG - Intronic
1122423515 14:101591909-101591931 GTCATGACTCTCTGCAAGTTGGG - Intergenic
1126486540 15:49187707-49187729 GGCATTACTCACTACAGGCTGGG - Intronic
1138806793 16:60099886-60099908 GGCAGTACTCACTGCAAGCCTGG - Intergenic
1139344210 16:66292076-66292098 GTCACCACTCTCTACTAGTTAGG + Intergenic
1141914999 16:87089726-87089748 AGCAGTACTCTCTCCAAGAGAGG + Intronic
1147944724 17:44074455-44074477 GGCTGTCCTCTATACAAGGTGGG - Intronic
1149673126 17:58433392-58433414 GGCAGTAGTGTATACAAGTGAGG + Intronic
1155687575 18:28574349-28574371 GGCAGTAATCTCTGCAGGATTGG - Intergenic
1161469706 19:4450458-4450480 GGCAGCACTCTTTACATATTAGG - Intronic
933180395 2:79220353-79220375 GGCAGAACTGTTTACAAGTGTGG + Intronic
936901291 2:117484762-117484784 GGCAGTACTCGCCACAGGTCTGG - Intergenic
937325428 2:120987304-120987326 GCCAGTAGTCCCCACAAGTTGGG - Intronic
940021449 2:149160415-149160437 GGCAGAACTCTCTACAACACTGG - Intronic
945300365 2:208210589-208210611 GGCACTACTCTCATCAAGGTTGG + Intergenic
945306161 2:208260902-208260924 GGAAGTGCTCTCAACAAATTAGG + Intronic
1170421636 20:16199447-16199469 TGCAGTAGTCTCTAGAAGGTGGG - Intergenic
950812790 3:15665661-15665683 GGCAGTATTCTCTGCCATTTTGG - Intergenic
951328418 3:21334514-21334536 GACAGCACTCTCAACATGTTAGG + Intergenic
955452073 3:59079206-59079228 GGCAGTTCTCTGTAGCAGTTAGG - Intergenic
957283936 3:78191167-78191189 AGAAGTGCTCTCTGCAAGTTGGG - Intergenic
959350011 3:105250157-105250179 TTCAGTACTCTCAACAAGTTGGG - Intergenic
967204859 3:187110283-187110305 ATCATTACTCTCTACAAATTTGG - Intergenic
968937582 4:3620316-3620338 GAAAGTACACTCTACAAGGTGGG + Intergenic
968937587 4:3620366-3620388 GAAAGTACACTCTACAAGTTGGG + Intergenic
971260261 4:25050571-25050593 GACAGTACTCTCTGAAAGCTGGG + Intergenic
979836000 4:125368196-125368218 CACAGTACTCTCTACAAATCTGG - Intronic
981140277 4:141259699-141259721 GGCAGTACTCACTACAGGCCTGG + Intergenic
992566172 5:77997280-77997302 GGCAGAATTATCTACCAGTTAGG + Intergenic
994315419 5:98327303-98327325 GGCAGGACTCTCAACACGTGGGG - Intergenic
997440354 5:133904851-133904873 GGCAGGACTCTCTACAGGACAGG - Intergenic
1000431881 5:161162209-161162231 GGTGGTACTCTCTCCAATTTAGG - Intergenic
1005125565 6:22442922-22442944 GGCAGTTCTCACTACAAGGGTGG + Intergenic
1006245382 6:32730196-32730218 AGCAGCACTCTCTGCAATTTGGG + Intergenic
1006266722 6:32931766-32931788 GGGAGTAGTCTCTATAGGTTTGG + Intergenic
1008641988 6:53473819-53473841 GGCAGTACTCGCCACAAGCCTGG - Intergenic
1011732398 6:90278677-90278699 AGCAGTAATCTCTAAAAGTAGGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020405527 7:7829307-7829329 GCAATAACTCTCTACAAGTTTGG + Intronic
1027524114 7:79245490-79245512 GGCAGTACTCTCTACAAGTTCGG + Intronic
1027932656 7:84558242-84558264 TGGAGTGCTCTCTACATGTTTGG - Intergenic
1035754004 8:2017680-2017702 GGCAGTACTCGCTGCAGGTTGGG - Intergenic
1036453658 8:8891080-8891102 GGCAGTACTCTGTGTAAGTTGGG + Exonic
1039950314 8:42166361-42166383 GGAAGTACTCAATACATGTTAGG + Intronic
1046650981 8:116836283-116836305 GGCAGTGCTCTCAAGAACTTGGG + Intronic
1054453570 9:65417326-65417348 GAAAGTACACTCTACAAGGTGGG - Intergenic
1054453574 9:65417376-65417398 GAAAGTACACTCTACAAGGTGGG - Intergenic
1055006485 9:71513087-71513109 GGCAGAAGTCTATACAAGTTTGG + Intergenic
1187785614 X:22882436-22882458 GGCAGTACTTTCTCAAACTTTGG + Intergenic
1195979085 X:110558890-110558912 GGCACTCCTCTCTTCAATTTGGG + Intergenic
1196962075 X:121014366-121014388 GGCAGTACTCACCACAAGCCTGG - Intergenic
1198339843 X:135702931-135702953 GGCTGTACTCTCATCAATTTGGG + Intergenic
1200910207 Y:8525125-8525147 GGCATTGCTCTCTCCCAGTTGGG + Intergenic