ID: 1027526467

View in Genome Browser
Species Human (GRCh38)
Location 7:79275751-79275773
Sequence GTAGAATAGTAAGTGAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027526467_1027526469 -8 Left 1027526467 7:79275751-79275773 CCAGTGTTCACTTACTATTCTAC 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1027526469 7:79275766-79275788 TATTCTACAAGTCTAAAAAAGGG No data
1027526467_1027526468 -9 Left 1027526467 7:79275751-79275773 CCAGTGTTCACTTACTATTCTAC 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1027526468 7:79275765-79275787 CTATTCTACAAGTCTAAAAAAGG 0: 1
1: 0
2: 1
3: 28
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027526467 Original CRISPR GTAGAATAGTAAGTGAACAC TGG (reversed) Intronic
901255121 1:7817890-7817912 GTAAAATAGTAACTTTACACAGG + Intronic
906953746 1:50355285-50355307 TTAGAATAGTAAATGAGCATTGG - Intergenic
907041563 1:51265380-51265402 GTAGAATAGAAATGGAAGACAGG - Intronic
910187641 1:84560727-84560749 TTGGAATGGTAAATGAACACTGG - Intronic
911868371 1:103057893-103057915 TTAAAATGGTAAGTGAGCACTGG + Intronic
914689532 1:150013111-150013133 GTAGAATAGTAAGGGAAAAAAGG + Intergenic
916169641 1:161991896-161991918 TTAGAATGGTAAATGAGCACTGG + Intronic
916956824 1:169846322-169846344 TTTTAATAGTAAGTGAACATTGG + Intronic
919113363 1:193248158-193248180 TTAGAATGTTAAGTGACCACTGG - Intronic
921897750 1:220418134-220418156 TCAGAACAGTAAGTGAGCACTGG - Intergenic
924921399 1:248633238-248633260 ATAGAATTCTAAGTGACCACTGG + Intergenic
1062953981 10:1528238-1528260 GCAGTTTAGGAAGTGAACACGGG - Intronic
1063801953 10:9589958-9589980 TCAGAATGGTAAATGAACACTGG + Intergenic
1064467946 10:15603874-15603896 CTAGAAAAGTCAGTGAAGACAGG + Intronic
1065439583 10:25737416-25737438 TCAGAATGGTAAGTGAGCACTGG - Intergenic
1066516712 10:36170132-36170154 GTGGAACAGTAGGTGAAAACTGG - Intergenic
1068281449 10:54876079-54876101 TCTGAATGGTAAGTGAACACTGG - Intronic
1071842385 10:89485784-89485806 GTAGATCAGTAGGTGCACACTGG + Intronic
1071961956 10:90815599-90815621 GAAGAATAGCTAATGAACACTGG + Intronic
1072045704 10:91652580-91652602 GTATATTAATGAGTGAACACTGG + Intergenic
1072885048 10:99265462-99265484 GAAGAATAGCTAGTGGACACTGG + Intergenic
1073598927 10:104827620-104827642 TTGGAATGGTAAGTGAGCACTGG + Intronic
1074084613 10:110199300-110199322 TCAGAATAGTAAATGAGCACTGG + Intergenic
1078556325 11:12329519-12329541 GTGGAATAGAATTTGAACACAGG - Intronic
1080671054 11:34378382-34378404 TCAGAATGGTAAATGAACACTGG - Intergenic
1081226129 11:40525059-40525081 GAAGAATAGTAAGAAAACAAGGG + Intronic
1082761786 11:57133972-57133994 TTAGAATAGTAAATGAGCACTGG + Intergenic
1082889957 11:58128211-58128233 GTAGAATAGTAGGGGCAAACAGG + Intronic
1085422762 11:76378330-76378352 GTAGAATAGTTTGTGAACATCGG + Intronic
1085633181 11:78136694-78136716 TTAGAATAGTAAGTGAGAAATGG + Intronic
1085757661 11:79215136-79215158 GTGAAATTGTAAGTGAAAACTGG - Intronic
1086856225 11:91869294-91869316 GTAGACGAGTCTGTGAACACTGG + Intergenic
1088024840 11:105165761-105165783 GAAGAATAGTAAGTGTAGAAAGG - Intergenic
1088136235 11:106559231-106559253 CTAGAATGCTAAGTGAACACTGG - Intergenic
1088154275 11:106784368-106784390 GTAGAAAACTAAGTCATCACAGG + Intronic
1092075953 12:5673748-5673770 GGAGAATAGGAAGTGACCACTGG - Intronic
1094558354 12:31525520-31525542 GGAGAATGGGGAGTGAACACAGG + Intronic
1096645527 12:53032639-53032661 GTAGAAGAGTAATTGAACTTGGG + Intronic
1098869134 12:75797182-75797204 GTAGAAGACTGAGTGAAGACGGG + Intergenic
1100519708 12:95362063-95362085 GAAGAATATGAAGAGAACACAGG + Intergenic
1100901689 12:99248602-99248624 GTAGAATAGTGAGTGGATAGTGG + Intronic
1101094510 12:101323120-101323142 GTAAAATATTAAGTGAAAAAAGG - Intronic
1105868308 13:24481064-24481086 TTGGAATGGTAAGTGAGCACTGG - Intronic
1106973546 13:35176407-35176429 GTAGACTACTAAGTGAACTAGGG - Intronic
1109030982 13:57187112-57187134 GTAAAATAATAAGCAAACACTGG - Intergenic
1109965985 13:69696523-69696545 GTAGAATAGATAGTGTACACTGG + Intergenic
1110620303 13:77587022-77587044 GCAGAAGAGTAAGTGGACCCAGG - Intronic
1110766556 13:79285925-79285947 TTAGAATGGTAAATGAACATTGG - Intergenic
1112555898 13:100468281-100468303 TCAGAATGGTAAGTGAGCACTGG + Intronic
1112950532 13:104990369-104990391 GTGGAAAAGTTAGTGAAGACAGG + Intergenic
1114906307 14:27131604-27131626 GTAGAATAAGAAGTCAACAGAGG - Intergenic
1115249853 14:31333694-31333716 TTGGAATGGTCAGTGAACACTGG - Intronic
1115620718 14:35137399-35137421 GTAGAAAAGAAAGTGAAGATGGG + Intronic
1116393205 14:44417852-44417874 ATAGAAGAATAAGTGCACACAGG - Intergenic
1116925011 14:50625585-50625607 GGGGAATGGTAAATGAACACTGG - Intronic
1117401393 14:55361467-55361489 TTGGAATGGTAAATGAACACTGG + Intronic
1118136843 14:63038011-63038033 TTGGAATAGGAAGTGAACATGGG + Intronic
1120760040 14:88276566-88276588 GGAGAAGAGAAAGAGAACACAGG - Intronic
1122431842 14:101655784-101655806 GCAGAATGGTAAATGAACACCGG - Intergenic
1123586213 15:21762767-21762789 GGAGAATAGGAAGTGACCACTGG + Intergenic
1123622854 15:22205357-22205379 GGAGAATAGGAAGTGACCACTGG + Intergenic
1123779571 15:23613099-23613121 GAACAATAAAAAGTGAACACAGG + Intronic
1124036608 15:26058772-26058794 TTGGAATAGCAAATGAACACTGG - Intergenic
1124878842 15:33622707-33622729 GTTCAACAGTAATTGAACACTGG - Intronic
1125339021 15:38656370-38656392 ATAGAATAGAAAATGAAGACAGG + Intergenic
1126991264 15:54378736-54378758 GAAAAATAGTAACTGAACATAGG - Intronic
1130228194 15:82076085-82076107 ATATAATAGTAAATGAACTCTGG - Intergenic
1130617369 15:85424090-85424112 TTAGAATGGTAAGTGAGCATTGG + Intronic
1135013677 16:18906075-18906097 ATAGAATGGGAAGTAAACACTGG - Intronic
1135320620 16:21493644-21493666 ATAGAATGGGAAGTAAACACTGG - Intergenic
1135373455 16:21925134-21925156 ATAGAATGGGAAGTAAACACTGG - Intergenic
1135438334 16:22445568-22445590 ATAGAATGGGAAGTAAACACTGG + Intergenic
1135499638 16:22982939-22982961 TTAGAAGAGTAAGTCCACACTGG + Intergenic
1136330834 16:29575343-29575365 ATAGAATGGGAAGTAAACACTGG - Intergenic
1136445469 16:30315071-30315093 ATAGAATGGGAAGTAAACACTGG - Intergenic
1139532306 16:67548329-67548351 GGGGAAGAGGAAGTGAACACTGG + Intergenic
1139619337 16:68124523-68124545 GGAGAATGGTAGGTGAACCCAGG - Intronic
1140593142 16:76376820-76376842 GTAGAAAAGGAAGTGAAGTCAGG + Intronic
1143930662 17:10420003-10420025 GTGGAGCAGTAAGTGAAAACAGG - Exonic
1145713932 17:27001585-27001607 TCAGAATGGTAAGTGAGCACTGG + Intergenic
1146101120 17:29983353-29983375 GTTGAAAAGTACTTGAACACTGG - Intronic
1149192142 17:54075744-54075766 TTAGAATAGTAGGTGAGCATGGG - Intergenic
1152135516 17:78501036-78501058 GTAGAACTGAATGTGAACACAGG + Intronic
1153288010 18:3474331-3474353 TTAGAATAGTAAGTGAGCATTGG - Intergenic
1153686464 18:7551270-7551292 GCAGAAAAGTTAGTGAAAACTGG - Intergenic
1155890971 18:31268427-31268449 GAAAAATAGAAAGTGAAGACCGG + Intergenic
1156212318 18:34958192-34958214 GTAGGATACAAAGTAAACACTGG - Intergenic
1156596150 18:38550533-38550555 ATAGACTAGTAAGTGAATAAAGG - Intergenic
1157008758 18:43620599-43620621 GGAGAAAAATAAATGAACACTGG + Intergenic
1158211999 18:55061814-55061836 CCAGAATAGTAAATGAACATTGG + Intergenic
1158716360 18:59883257-59883279 GGAGACTGGTAAGTGAATACAGG + Intergenic
1158790347 18:60773180-60773202 TTAGAATGGTAAATGAGCACTGG + Intergenic
1160209759 18:76867059-76867081 GTAAAAGAGTAAGTGAAAAGAGG + Intronic
1162595177 19:11623094-11623116 GTAAAAGAGCAATTGAACACAGG - Intergenic
1163868718 19:19799312-19799334 GTATATTAGTAAGGGAACAGAGG + Intronic
1164960606 19:32425848-32425870 TCAGAATGGTAAGTGAACATTGG + Intronic
1165787740 19:38472408-38472430 GTGGAATTGTAACTGAACACAGG + Intronic
925197924 2:1942267-1942289 GTCGGATAGTAACAGAACACTGG + Intronic
925495376 2:4442681-4442703 GAAGAATAGGAAGTGAGCAAAGG + Intergenic
926785460 2:16513742-16513764 GATGAATAGTAAATAAACACAGG + Intergenic
927829849 2:26340092-26340114 GTAAAATTGCAATTGAACACAGG - Intronic
929134634 2:38611763-38611785 GGAAACTAATAAGTGAACACTGG + Intergenic
929180882 2:39037753-39037775 TCAGAATGGTAAGTGAACACTGG - Intronic
929529699 2:42740837-42740859 TTGGAATAGTAAATGAACACTGG + Intronic
929757836 2:44782480-44782502 GCAGAATGGTAAATGAGCACTGG - Intergenic
930948589 2:57108530-57108552 GTAGACTAGTAAGTGTGCAATGG + Intergenic
933465906 2:82651206-82651228 TTAGAATAGTAAATGATCATTGG + Intergenic
935493424 2:103748211-103748233 GTAGAGAAGTAAGGGAAAACAGG - Intergenic
935974357 2:108562944-108562966 TTGGAATAGTAAATGAGCACTGG - Intronic
936798206 2:116233028-116233050 TCAGAATAGCAAATGAACACTGG - Intergenic
939196277 2:138977062-138977084 GGAGAATACCAAGTGAAGACTGG + Intergenic
943959457 2:194242878-194242900 CAAAAATAGGAAGTGAACACTGG + Intergenic
943994482 2:194742931-194742953 GGAGAAATGTATGTGAACACTGG - Intergenic
944657806 2:201893687-201893709 GAGAAATTGTAAGTGAACACAGG - Exonic
948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG + Intronic
1171236635 20:23532000-23532022 TCAGAATAGTAAATGAACATTGG + Intergenic
1173187477 20:40851728-40851750 AAAGAATAGTAAGTGAATATCGG + Intergenic
1173669941 20:44791903-44791925 GTACATTAGGAAGTGGACACAGG - Intronic
1173980045 20:47216814-47216836 GTAGAATAAAAAAAGAACACAGG + Intronic
1174592229 20:51655219-51655241 ATAAAATAGTAAGTGAAAAAAGG + Intronic
1184082946 22:42237957-42237979 TTAGAATGGTAAATGAGCACTGG + Intronic
950562175 3:13738174-13738196 TTGGAATGGTAAGTGAACACTGG - Intergenic
952055330 3:29437461-29437483 AAAGAATATTAAGTGAACAGAGG + Intronic
954052323 3:47990480-47990502 ATAGAATAAGAAGTTAACACAGG - Intronic
954395493 3:50291314-50291336 GTAGAATAGTAAGATAAAATGGG - Intronic
959721644 3:109497240-109497262 TTAGAATGGTAAATGAACATTGG + Intergenic
963587808 3:147215109-147215131 TTATATTAGTAAGTAAACACAGG + Intergenic
963882480 3:150544627-150544649 GTATAATAAGAAGTGAAGACAGG + Intronic
964061458 3:152529474-152529496 TCAGAATAGTCAGTGAGCACTGG + Intergenic
964702439 3:159584077-159584099 GGAGAATATTAAGTGAAAAGAGG - Intronic
966024032 3:175253246-175253268 TTAGAATGGTAAATGAGCACTGG - Intronic
970129307 4:12849382-12849404 AAATAATAGTAAGAGAACACGGG + Intergenic
971300002 4:25434152-25434174 AGAGAGTAGTAAGAGAACACAGG + Intergenic
972122338 4:35719824-35719846 GTAGAGTAATAAGTACACACTGG - Intergenic
975376836 4:73656071-73656093 AGAGAATAGTAAGTAAAGACTGG + Intergenic
975567953 4:75779978-75780000 TCAGAATGGTAAGTGAGCACTGG - Intronic
975830999 4:78368729-78368751 TTAGAATAGAAAGTTAACAAAGG + Intronic
976615947 4:87077199-87077221 GAAGTTTAGCAAGTGAACACTGG + Intronic
976734721 4:88297827-88297849 GAGGAATAGTATGTGAGCACAGG - Intergenic
977158428 4:93603725-93603747 TCAGAATGGTAAGTGAGCACTGG - Intronic
977194392 4:94041397-94041419 TCAGAATGGTAAATGAACACTGG + Intergenic
977324489 4:95557465-95557487 ATAGAATAGGAAGTGACCAAAGG + Intergenic
977331781 4:95645520-95645542 GTAGAAGAGGAAGGGAACAATGG + Intergenic
979345576 4:119582963-119582985 TTAGAATGGTAAGTGAGCACTGG + Intronic
979517855 4:121631598-121631620 TTACAAGAGTAAATGAACACTGG - Intergenic
980159973 4:129149152-129149174 GAAGAACAGTAACTGAACACAGG - Intergenic
980526221 4:133993872-133993894 GTAGAAGAAAAAGTGCACACAGG + Intergenic
983290185 4:165792779-165792801 TTAGAATGGTAAATGAACATGGG + Intergenic
984051610 4:174871498-174871520 GTGAAATAGTAAGTGAACAAAGG - Intronic
984054685 4:174912642-174912664 TCAGAATAGTAAATGAGCACTGG + Intronic
984461139 4:180038475-180038497 TTAGAATTGTAAGTGAGCATTGG - Intergenic
985188274 4:187342304-187342326 TCAGAATGGTAAGTGAACACTGG + Intergenic
985334939 4:188882528-188882550 GCAAAATAGTAAGCGAACACTGG + Intergenic
985424192 4:189812549-189812571 GGGGAATAGCAAGTGATCACTGG - Intergenic
985939528 5:3123783-3123805 GTACAATAGTAACTTAACACAGG + Intergenic
987246936 5:16058647-16058669 GAAGCATAGGAAGTGAGCACAGG + Intergenic
987797295 5:22644825-22644847 TCAGAATAGTAAATGATCACTGG - Intronic
989085692 5:37673727-37673749 GAAGAATAGCTAATGAACACTGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992601952 5:78410244-78410266 GAAGAATAGTTAGTGAATGCTGG - Intronic
994517413 5:100787983-100788005 TTAGAATGGTAAATGAGCACTGG + Intergenic
994675495 5:102816240-102816262 GTAAAATAGTAATTTTACACAGG - Intronic
996405987 5:123103727-123103749 GTAGAATTTTAAGTATACACTGG - Intronic
997695022 5:135854206-135854228 TCAGAATGGTAAGTGAGCACTGG + Intronic
999509609 5:152235236-152235258 TTAGAATGGTAAATGAACATTGG + Intergenic
999547953 5:152651691-152651713 TTAGAATACTAAATTAACACTGG - Intergenic
999884735 5:155909422-155909444 GTGGAATAGCAAGTGAATAAAGG - Intronic
1000186370 5:158862424-158862446 GTAGAATGGCAGGTGAAGACAGG - Intronic
1000838792 5:166189828-166189850 TCAGAATAGTAAATGAACATTGG - Intergenic
1004820515 6:19363294-19363316 ACAGAATAGTAACAGAACACAGG + Intergenic
1005971138 6:30762842-30762864 GTAGAAATGTGACTGAACACAGG + Intergenic
1008682324 6:53885905-53885927 GTAGAGTAGTAAAAAAACACAGG - Intronic
1009265540 6:61550312-61550334 ATAGTATCCTAAGTGAACACAGG - Intergenic
1009542389 6:64978237-64978259 GGGGAATGGTAAATGAACACTGG - Intronic
1012928527 6:105292591-105292613 TCAGAATGGTAAATGAACACTGG + Intronic
1013172751 6:107651793-107651815 TCAGAACAGTAAGTGAACACTGG - Intronic
1013870371 6:114751084-114751106 GTAGTATACAAAGTGAAAACTGG - Intergenic
1014775105 6:125499767-125499789 TTGGAATAGTAAATGAGCACTGG + Intergenic
1015020478 6:128467599-128467621 GAAGAGAAGTAAGTGATCACCGG - Intronic
1016423096 6:143905395-143905417 GTAGAACAGAAAGTCAACACAGG - Intronic
1016621494 6:146114627-146114649 GTACAATAGTAAGTAAAAGCAGG + Intronic
1017068900 6:150554920-150554942 TCAGAATGGTAAATGAACACTGG - Intergenic
1018103322 6:160460549-160460571 GGAGAACAGTAATTGAGCACAGG + Intergenic
1018527707 6:164731878-164731900 GTGGAATACTAAGAGTACACAGG + Intergenic
1018691669 6:166350133-166350155 TCAGAATGGTAAGTGAACATTGG + Intergenic
1019149576 6:169995472-169995494 TAACAATACTAAGTGAACACAGG - Intergenic
1020604279 7:10316501-10316523 GGAGAATAGTATTTGAGCACTGG - Intergenic
1021257822 7:18415714-18415736 GCAAAATTTTAAGTGAACACAGG - Intronic
1021974678 7:26000087-26000109 TCAGAATGGTAAGTGAGCACTGG + Intergenic
1023026140 7:36051708-36051730 CTAGAATAGTAAATGAGCATTGG - Intergenic
1023676217 7:42632922-42632944 GTAGAATAGCAAGAAAACATTGG + Intergenic
1023840623 7:44095684-44095706 GTAGAAAAATAAGAAAACACAGG - Intergenic
1027526467 7:79275751-79275773 GTAGAATAGTAAGTGAACACTGG - Intronic
1028408546 7:90502848-90502870 TTGGAATAGTAAGTGAGCACTGG + Intronic
1031368329 7:120931770-120931792 GTAGAATAGAAAGGGAAGATAGG + Intergenic
1033951900 7:146795318-146795340 GGAGAATACTAAGTAAACTCAGG - Intronic
1035544523 8:469298-469320 TTTGAATAGAAAGTGAACCCAGG + Exonic
1039983920 8:42431733-42431755 TTGGAATGGTAAGTGAACATTGG - Intronic
1041298174 8:56383341-56383363 GTAGAATAGAAAGCAGACACTGG + Intergenic
1041540283 8:58976962-58976984 TCAGAATGGTAAATGAACACTGG + Intronic
1041647072 8:60263880-60263902 ATAGAGCACTAAGTGAACACTGG + Intronic
1044554624 8:93549545-93549567 GAAGAATAGCTAATGAACACTGG + Intergenic
1045232873 8:100322054-100322076 GTGGAATGGTAAATGAACACTGG + Intronic
1045465498 8:102465788-102465810 TTAGAACAGTCAGTGAGCACCGG + Intergenic
1045746738 8:105431476-105431498 ATACAATGGTAAGTAAACACAGG + Intronic
1046003518 8:108449642-108449664 GTAGAAAATTAATTGAACAAGGG - Intronic
1046571683 8:115974176-115974198 TCAGAATGGTAAATGAACACTGG + Intergenic
1046937140 8:119895429-119895451 GTAGGATAGTAAGAGGACAGAGG - Intronic
1047049177 8:121091209-121091231 TTGGAATGGTAAATGAACACTGG + Intergenic
1048817413 8:138346697-138346719 GAAGAATAGCCAATGAACACTGG + Intronic
1050564994 9:6872841-6872863 TTAGAATGGTAAATGAACATTGG + Intronic
1051147131 9:14039228-14039250 TTAGAATAGTAAATGAGCATTGG + Intergenic
1051254241 9:15195947-15195969 TTGGAATGGTAAGTGAACATTGG - Intronic
1051852935 9:21529822-21529844 CTAGAATGGTAAATGAGCACTGG + Intergenic
1052111287 9:24585972-24585994 TCAGAATGGTAAGTGAGCACTGG + Intergenic
1054453192 9:65414141-65414163 GCAGAAGAGTAAGGGAACAAGGG + Intergenic
1055039370 9:71852358-71852380 CCAGAATGGTAAATGAACACTGG + Intergenic
1057720529 9:97528313-97528335 GGAGAAAAGTAATTGAGCACAGG + Intronic
1058987658 9:110223714-110223736 GAAAAATAGTAAGTCAATACTGG - Intergenic
1059182035 9:112225241-112225263 GAGGAATAGAAAGTGAACCCAGG - Intronic
1060669607 9:125458309-125458331 GCAGATTAATAAGTGAACAAAGG + Intronic
1187026718 X:15443130-15443152 TTACAATGGTAAATGAACACTGG - Intronic
1189014593 X:37083908-37083930 TTGGAATAGTAAATGAGCACTGG - Intergenic
1189677799 X:43480316-43480338 ATAGAATATAAAGTGAAGACAGG + Intergenic
1189841697 X:45086075-45086097 GCTGAATGGTAAGTGAATACTGG - Intronic
1190154664 X:47979722-47979744 CTAGAATATTAAGTGAAAAATGG + Intronic
1190927482 X:54922332-54922354 GAAGAGCAGTAAGTGAACTCAGG - Intronic
1192612735 X:72584169-72584191 TTTGAAAAGTAAGTGATCACTGG + Intronic
1194364767 X:93001462-93001484 TCAGAATAGTTAATGAACACTGG - Intergenic
1195557921 X:106248521-106248543 TGAGAATAATAAGTGGACACAGG + Intergenic
1196505001 X:116431442-116431464 GTAAAATAGTTAGAGAACATAGG + Intergenic
1197231774 X:124012986-124013008 ATAGAAGAGTAGATGAACACAGG - Intronic
1197294141 X:124696777-124696799 GTAGATTCATAAGTGAACAAAGG + Intronic
1200672993 Y:6117723-6117745 TCAGAATAGTTAATGAACACTGG - Intergenic
1201632698 Y:16086907-16086929 GTATGATAGTAAAAGAACACAGG + Intergenic