ID: 1027532272

View in Genome Browser
Species Human (GRCh38)
Location 7:79351406-79351428
Sequence ATGCTCGTTAATAGCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027532272 Original CRISPR ATGCTCGTTAATAGCAAGGC TGG (reversed) Intronic
906000362 1:42419490-42419512 TTGCTAGTCAATAGCAAGGCTGG + Exonic
921290172 1:213649749-213649771 GTGCTCGGTACTAGGAAGGCAGG - Intergenic
1063543678 10:6959815-6959837 AAGCTTGTTAATAGCATGGGAGG - Intergenic
1070404731 10:76084844-76084866 TTGCTCATTAATAGCAGGGGTGG + Intronic
1072084996 10:92070284-92070306 ATGCTTGTTTAAAGAAAGGCTGG - Intronic
1076128688 10:127995995-127996017 AGGCTCTTTAAGACCAAGGCTGG - Intronic
1078769393 11:14333930-14333952 ATGCTCATTAAAAGTAAGGGCGG - Intronic
1080286698 11:30623038-30623060 ATGCTAATTAAAAGAAAGGCGGG - Intergenic
1085717943 11:78889684-78889706 AGGCTCCTTACTAGCATGGCAGG - Intronic
1087825843 11:102763854-102763876 ATGCTAGTCAATAGCAAGAAAGG + Intergenic
1090905106 11:131068060-131068082 ATGCTCTGTAATAGCACTGCTGG - Intergenic
1094016376 12:25869327-25869349 ATTCTCATTAAAATCAAGGCTGG + Intergenic
1094154268 12:27321072-27321094 CTGCTAGTTAATAACAAGGAAGG + Intronic
1094549583 12:31437884-31437906 ATGCTCTTACATAGCAAGGTTGG - Intronic
1106241099 13:27914347-27914369 ATGCACATTAAAAGCAATGCTGG + Intergenic
1108625903 13:52228644-52228666 ATACTCGGTAACAGCTAGGCCGG + Intergenic
1111412278 13:87892690-87892712 ATGCTCTTTAACAGCAAGCATGG + Intergenic
1114704843 14:24714587-24714609 ATGCTTGTTAGGAGCAGGGCTGG - Intergenic
1118637591 14:67762187-67762209 ATCCTTGGTAAGAGCAAGGCAGG - Exonic
1122043560 14:99007583-99007605 AGGCTCAGTAATAGCCAGGCAGG - Intergenic
1124931556 15:34124783-34124805 ATGCTCATTGACAGCATGGCAGG + Intergenic
1132066126 15:98732689-98732711 ATCCTAGTTAATGGCAAGGGTGG - Intronic
1135496508 16:22956357-22956379 ATGCAAGTTAAAAACAAGGCAGG + Intergenic
1140855472 16:78974391-78974413 AGGCTAGTGTATAGCAAGGCAGG - Intronic
1149531091 17:57395873-57395895 ATGCTAGTTAAAGGCAAGGCAGG - Intronic
1151646078 17:75432780-75432802 ATGCTCTTTGACAGCAAAGCTGG + Intergenic
1156723984 18:40105340-40105362 AGGCTCAATACTAGCAAGGCAGG + Intergenic
1157550966 18:48581781-48581803 ATTATCGGTCATAGCAAGGCAGG + Intronic
1166694009 19:44842052-44842074 AAGCAAGTTAGTAGCAAGGCTGG + Intergenic
926088074 2:10032541-10032563 ATGCGCGTGGATAGCATGGCTGG + Intergenic
930959706 2:57245835-57245857 ATGCTCATTGATAGAAAGACTGG - Intergenic
932899809 2:75684686-75684708 ATACTCAGTAATAGCATGGCTGG - Intronic
935075090 2:99733870-99733892 ATGTTCCTAAATAGCAAGGTTGG - Intronic
936925654 2:117734191-117734213 ATGTACGTAAATAGCATGGCTGG - Intergenic
941304080 2:163839471-163839493 ATTCATGTTAAAAGCAAGGCCGG - Intergenic
941415531 2:165216262-165216284 ATGCTGGTTAACACCAAGGCAGG + Intergenic
944461895 2:199958037-199958059 ATACTGCTTAATAGCAAGGAAGG - Intronic
1177461847 21:21422539-21422561 CTGCTCATTAATAGGAAGTCAGG - Intronic
957715092 3:83917861-83917883 ATCCTCATTATTAGCAAGGCAGG + Intergenic
958268149 3:91464323-91464345 ATACTCGGTAATAGCATTGCTGG + Intergenic
960820362 3:121724365-121724387 TTGCTAATTTATAGCAAGGCTGG - Intronic
966286766 3:178305962-178305984 ATGCTAGTTAGTAGTAATGCTGG + Intergenic
975995658 4:80310854-80310876 GAGCTTGTTAATGGCAAGGCAGG - Intronic
988634103 5:32963133-32963155 ATGTTCCTTCATAGCAATGCAGG - Intergenic
994010065 5:94891839-94891861 ATAACCGTAAATAGCAAGGCAGG - Intronic
995751954 5:115461296-115461318 ATGCTCGTCAGTAGCAGAGCTGG - Intergenic
997772129 5:136565009-136565031 ATGCCCTTTAATAGCATTGCTGG + Intergenic
1000761371 5:165229268-165229290 ATGCTTTTTAATGGCTAGGCTGG - Intergenic
1008987055 6:57557253-57557275 ATACTCGGTAATAGCATTGCTGG - Intronic
1009175012 6:60449820-60449842 ATACTCGGTAATAGCATTGCTGG - Intergenic
1010181905 6:73096363-73096385 GTGCTGATGAATAGCAAGGCAGG + Intronic
1027532272 7:79351406-79351428 ATGCTCGTTAATAGCAAGGCTGG - Intronic
1030449178 7:109687643-109687665 ATACTCATTAATGGGAAGGCTGG + Intergenic
1034537849 7:151737108-151737130 AAGCTGGTTAGTAGCAAAGCAGG - Intronic
1034543467 7:151775017-151775039 ATCCTCCTTAATGTCAAGGCTGG + Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1045670847 8:104551841-104551863 TTGCTGGGGAATAGCAAGGCAGG - Intronic
1047795653 8:128252800-128252822 AAGCTAGTAAATAGCAAAGCTGG + Intergenic
1056361522 9:85862269-85862291 ATGCTCAGTAATGGCATGGCTGG + Intergenic
1057126541 9:92620179-92620201 CTGCTTGTCAATGGCAAGGCAGG + Exonic
1058891001 9:109360571-109360593 ATGCTCCTTACTAGGGAGGCAGG + Intergenic
1061247079 9:129406053-129406075 CTGCTCGTTGATAGCCAGCCTGG + Intergenic
1192866662 X:75140776-75140798 ATGCTCTTTAATTTAAAGGCAGG + Intronic
1194385694 X:93252073-93252095 ATGCTGGTTACCAGAAAGGCTGG - Intergenic
1196665975 X:118317231-118317253 ATTTTTATTAATAGCAAGGCTGG - Intergenic