ID: 1027532791

View in Genome Browser
Species Human (GRCh38)
Location 7:79355440-79355462
Sequence CCATAAAACTAGTAGCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027532791_1027532796 6 Left 1027532791 7:79355440-79355462 CCTTGTAGCTACTAGTTTTATGG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1027532796 7:79355469-79355491 TCACTTTCTAGTGGTGTTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 578
1027532791_1027532795 3 Left 1027532791 7:79355440-79355462 CCTTGTAGCTACTAGTTTTATGG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1027532795 7:79355466-79355488 CCATCACTTTCTAGTGGTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
1027532791_1027532793 -3 Left 1027532791 7:79355440-79355462 CCTTGTAGCTACTAGTTTTATGG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1027532793 7:79355460-79355482 TGGTTTCCATCACTTTCTAGTGG 0: 1
1: 0
2: 3
3: 34
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027532791 Original CRISPR CCATAAAACTAGTAGCTACA AGG (reversed) Intronic
905676147 1:39826722-39826744 CCATAAAACTAGAAAAAACAAGG + Intergenic
910104517 1:83617326-83617348 CCATAAAACTAGGAGGTAAAGGG - Intergenic
914895999 1:151674072-151674094 CCATAAAACAAGTAACAAAATGG - Intronic
918673371 1:187249443-187249465 CCATGAAACTAGCAGCAATATGG + Intergenic
1064482018 10:15749267-15749289 CCATAAAACCTGTACCCACAGGG - Intergenic
1077793106 11:5462323-5462345 CCATAAAACTCTGAGCAACATGG - Intronic
1080975574 11:37335821-37335843 ACATACAACAAGTAGCTACCTGG - Intergenic
1081064593 11:38524512-38524534 CCATCAAACTAGTAAATAAAAGG + Intergenic
1082216965 11:49583104-49583126 CTATAAACCTAGAAGCTAAAAGG - Intergenic
1083124207 11:60547291-60547313 CTATAAAACAAGTAGCAAAATGG + Intergenic
1086632587 11:89041062-89041084 CTATAAACCTAGAAGCTAAAAGG + Intronic
1087158600 11:94927774-94927796 ACATAAAACTAGAAGCCAAATGG - Intergenic
1092641271 12:10513335-10513357 ACATAAAACTAGTGGCTATCAGG + Intronic
1095600827 12:44011283-44011305 CCATAACAATAGTATATACAGGG - Intronic
1098448878 12:70596534-70596556 TCATATGACTAGTAGCTAAATGG - Intronic
1104102914 12:125632013-125632035 CCAGAAAACTAGTAACAAAATGG - Intronic
1110557207 13:76873408-76873430 GCATAAAAATGGTAACTACAAGG + Intergenic
1115563968 14:34608543-34608565 CCATAAAACTCTGAGCTATATGG + Intronic
1119343607 14:73902472-73902494 TCATAAAACTAATTGCTCCAAGG - Intronic
1121185939 14:91969371-91969393 CAAAAATACTAGTAGCTATATGG - Exonic
1124689371 15:31809177-31809199 CCTTAAAAATAGTAGCACCAGGG - Intronic
1125665824 15:41429332-41429354 GCATTAAACAAGTAGCCACAGGG - Intronic
1127030884 15:54861264-54861286 CCAGAAAACAAGTAGCAAAATGG + Intergenic
1132257841 15:100393048-100393070 CCTTATAACAACTAGCTACATGG - Intergenic
1138879129 16:60989293-60989315 CCATAAAACTAGTAGTGCCAGGG + Intergenic
1140325116 16:73993913-73993935 CAATAATATTAGTAGTTACAGGG + Intergenic
1140416881 16:74780957-74780979 CCACAAAACTAGTGGCTAGTGGG - Intergenic
1144029310 17:11305262-11305284 CCATAAAACTAGCTACTTCATGG + Intronic
1155439095 18:25842681-25842703 CCAGAAAACAAGAAGCGACATGG + Intergenic
1156297080 18:35802392-35802414 CCATAAAGCTAGTAAATAGAAGG - Intergenic
1165088594 19:33369703-33369725 CCTCAAAAGTATTAGCTACATGG - Intergenic
1166184008 19:41127680-41127702 TCACAAAACTAGTAGTGACAGGG + Intronic
930394715 2:50806695-50806717 CCATCAAACTTTTAGGTACAAGG - Intronic
935080760 2:99791398-99791420 CAATAAAGCAAGTATCTACATGG - Intronic
935279514 2:101505473-101505495 CCATGAAACTAGTGGCTTGAAGG + Intergenic
936733726 2:115414337-115414359 CCATAAAACTAGTATCTGGCTGG - Intronic
937009667 2:118551284-118551306 CCACAAAACTAGCAGTTTCAAGG + Intergenic
940651258 2:156443216-156443238 GCATAAAAAGAGTAGCTAAAGGG - Intronic
942662308 2:178279180-178279202 GCATTTACCTAGTAGCTACATGG + Intronic
947342618 2:229156037-229156059 CAATAAAACAAGTTGCTACTGGG - Intronic
1169271246 20:4200960-4200982 CCATTAACTTACTAGCTACATGG + Intergenic
1171559373 20:26108924-26108946 CAAAAAAACAAGTAGCCACAGGG + Intergenic
1172454159 20:35053414-35053436 TCATAAAACTAGTGACTATATGG + Intronic
1174193905 20:48759211-48759233 CCATAAAACTACTGACTTCATGG + Intronic
1177502776 21:21979950-21979972 TCATAAAACTATTATCTAAAAGG + Intergenic
1184164373 22:42719146-42719168 CCATTAACCTAGCAGCTAGAGGG + Intronic
954341279 3:49955970-49955992 ACATAAAAGTAGTAGCAAAATGG - Intronic
954588913 3:51763175-51763197 CCATAAAACAATTAGCAAGATGG - Intergenic
956005645 3:64775726-64775748 CCTTAAAACTAGAAGATTCATGG + Intergenic
959565725 3:107831167-107831189 ACATAAAACTTCTAGCTATAGGG - Intergenic
961094518 3:124142953-124142975 TTATAAAGCTAGTAGCTATAGGG - Intronic
962722254 3:138187193-138187215 CCGTAAAACTCGTAGCGTCAGGG + Intergenic
964294455 3:155218105-155218127 CAGTAAAACTATTAGCCACATGG + Intergenic
964698927 3:159541535-159541557 CCATAAATCTATCAGCCACAAGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
971937453 4:33170484-33170506 CCACAAATCCAGTAGCCACAAGG - Intergenic
974560690 4:63513206-63513228 TCATAATATTTGTAGCTACATGG - Intergenic
976016605 4:80562257-80562279 CCATAAAACAAATAACAACATGG + Intronic
976517648 4:85987417-85987439 CCATACAACTAAAAACTACAAGG + Intronic
981956093 4:150476369-150476391 CCAAAGCACTAATAGCTACATGG + Intronic
983786699 4:171740776-171740798 CCATAAAACAAATAACTACACGG + Intergenic
995341050 5:111059884-111059906 ACATAAAATTCGTAACTACAGGG + Intergenic
995790041 5:115876974-115876996 CCATAAAAATACTAGCACCATGG - Intronic
999011803 5:148050115-148050137 CACTAAAAAGAGTAGCTACATGG - Intronic
1009795813 6:68465772-68465794 CTGCAAAACTAGTAGCTAAAAGG - Intergenic
1010421360 6:75680196-75680218 CCAGAAAACTAGGAGCTACCTGG - Intronic
1010512059 6:76731883-76731905 GCATAAACCTATTATCTACAGGG - Intergenic
1011132977 6:84071415-84071437 GCAGAAAACTACTAGCTAGAAGG - Intronic
1014104365 6:117546416-117546438 CCATAGAACTAGAAGCTCCCAGG + Intronic
1014479805 6:121921923-121921945 CCTTATATCTAGTAACTACAGGG - Intergenic
1016687799 6:146900970-146900992 CCCTAAGCCTAGTAGCTGCAGGG - Intergenic
1020351989 7:7230335-7230357 AAAAAAAACTAGTAGTTACATGG - Intronic
1025157271 7:56619306-56619328 CCCTAAAACTAGTAAACACAGGG + Intergenic
1027532791 7:79355440-79355462 CCATAAAACTAGTAGCTACAAGG - Intronic
1028057861 7:86270632-86270654 CCATAAAATTGGTAACTACAAGG + Intergenic
1033720066 7:144049807-144049829 CCCTAAAACTAGTAAACACAGGG + Intergenic
1038713232 8:29968351-29968373 CCACAAAAGTAGAAGCTGCATGG + Intergenic
1042668601 8:71234730-71234752 CCATAAAACTAGATGGCACAGGG - Intronic
1043035624 8:75194552-75194574 CCAAACAACTAGAAGCTATAAGG + Intergenic
1044623299 8:94212146-94212168 CCAAAAAAGTAAGAGCTACATGG - Intronic
1046882557 8:119325705-119325727 CCATAAAAATATTAGTTAGAAGG + Intergenic
1047093428 8:121597869-121597891 CCATAAAAGTATTAGTTTCAAGG - Intergenic
1047652429 8:126937467-126937489 CTATAAATCTTCTAGCTACAAGG + Intergenic
1051343987 9:16136208-16136230 ACATAAAATAAGTAGCTGCAAGG - Intergenic
1051570029 9:18545354-18545376 CCATAACACCAGGAGCTATATGG + Intronic
1052954211 9:34240734-34240756 GCATAAAGCTGGTAGCTAAATGG - Intronic
1053403210 9:37846951-37846973 CCATAAGAATAGAAACTACAGGG + Intronic
1053518771 9:38755337-38755359 CCATAAAAAGAGAAGCTAAATGG - Intergenic
1186374415 X:8982883-8982905 CATTAAAACTACTAGATACAGGG + Intergenic
1188240029 X:27774816-27774838 GCATAAAACTAGAAGCTCCTTGG - Intergenic
1190540508 X:51473254-51473276 CCATGCTACTAGTAGCAACAAGG - Intergenic
1193777081 X:85656697-85656719 CCATTCAACAAGTATCTACAAGG - Intergenic
1194239386 X:91425066-91425088 CCACAAAACTAGTGCTTACAGGG - Intergenic
1199327647 X:146518543-146518565 CCAGAAAACAAGTAACAACACGG - Intergenic
1199345952 X:146740194-146740216 CCACAAAACTAGTTGAAACATGG + Intergenic
1202132371 Y:21624917-21624939 CCATAAAAATAGTATCTAAAAGG - Intergenic