ID: 1027533581

View in Genome Browser
Species Human (GRCh38)
Location 7:79367140-79367162
Sequence ATGGGTAAGTGGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 882
Summary {0: 1, 1: 0, 2: 8, 3: 78, 4: 795}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027533581 Original CRISPR ATGGGTAAGTGGAAGGAAGA GGG (reversed) Intronic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900498790 1:2989569-2989591 ATGGACAAATGGATGGAAGATGG - Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900531870 1:3157883-3157905 AGGTTTAAGTGGGAGGAAGATGG - Intronic
900535880 1:3177114-3177136 ATGGGTGAATGAATGGAAGATGG - Intronic
901040313 1:6359462-6359484 AGGGGTTGGGGGAAGGAAGAGGG - Intronic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
902175852 1:14650149-14650171 GTGGGTATGTGGAAGGAAGTAGG + Intronic
902892551 1:19454942-19454964 CTTGGTAAAGGGAAGGAAGAGGG + Intronic
904436722 1:30503724-30503746 ATGGCTTGGTGGAAGGAAGCTGG + Intergenic
904487969 1:30840116-30840138 ATGGGTGGGTGGATGGATGATGG + Intergenic
904609275 1:31716038-31716060 AGGGATAACTGCAAGGAAGAAGG - Intergenic
904772029 1:32886120-32886142 GTGGGTATGGGGAAGGAAGCGGG + Intronic
904929001 1:34071597-34071619 ATGACTTAGTGGAAGGTAGATGG - Intronic
905363895 1:37438431-37438453 ATGGGTAAAGGGAAGCAAGAGGG + Intergenic
906069961 1:43008920-43008942 ATGGGAATGTGGGAGGAGGAGGG + Intergenic
906114548 1:43348041-43348063 ATGAGTAAGGGGAAGGGATAAGG - Intronic
906328040 1:44860774-44860796 ATGGGCAGCTGGAAGGGAGAAGG + Intronic
907007263 1:50927653-50927675 AGGGGTAATTGAATGGAAGAAGG + Intronic
907770116 1:57453076-57453098 ATGGGAAAGGGGTAGAAAGAAGG + Intronic
907912793 1:58841495-58841517 AGGGACAAGTGGAAGGAAGGTGG + Intergenic
908381897 1:63604755-63604777 CTGGGTAACTGGAAGGAATCTGG - Intronic
908391416 1:63686913-63686935 ATGAAGAAGTGGATGGAAGAAGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908943868 1:69470386-69470408 AGGGCTAAGTGAATGGAAGAAGG + Intergenic
910130700 1:83902058-83902080 ATGGGAATGTGGTGGGAAGATGG - Intronic
910488899 1:87746347-87746369 ATGGGGAACTGGAAAGGAGATGG - Intergenic
911367212 1:96953139-96953161 ATGGGTAGATGGGAGGAACAAGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912139335 1:106702715-106702737 AAGGGAAAGGGCAAGGAAGAAGG - Intergenic
912509522 1:110179505-110179527 AAGGGGAAGGGAAAGGAAGAAGG - Intronic
912797568 1:112702171-112702193 TTGTGTAAGTGGCTGGAAGAAGG - Intronic
914351361 1:146842974-146842996 ATGGGTGGGTGGATGGATGATGG + Intergenic
914880588 1:151543643-151543665 CTGGGTAAGTGGAACGATGGAGG + Intronic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
918291711 1:183114716-183114738 GTGGGTAAGTGACAGGAAGATGG + Exonic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918840236 1:189526376-189526398 ATGAGTAAGCGGAAGTAAGAAGG + Intergenic
919123705 1:193371600-193371622 ATGGGTTAATGGATGGAAGAGGG + Intergenic
919881753 1:201905650-201905672 ATGGGTCACAGGAAGGAAGAAGG - Intronic
920559609 1:206930025-206930047 ATGGGTCCCTTGAAGGAAGAGGG - Exonic
920748006 1:208647195-208647217 AGGGGGAAGGGGAAGGGAGAGGG - Intergenic
921264967 1:213414778-213414800 ATGGGTAACTGGAAGCAGGAGGG + Intergenic
921364984 1:214365129-214365151 ATCAGTGAGGGGAAGGAAGAAGG - Intronic
921569637 1:216763066-216763088 ATGGGTTAGTGCAGGCAAGAAGG + Intronic
921584746 1:216933891-216933913 AGGGGTCAGTGGAGGGAAGATGG - Intronic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
922300189 1:224292566-224292588 ATGAGTAAGTGTAAGTAAGGAGG - Intronic
922600261 1:226845933-226845955 ATTGGAATTTGGAAGGAAGAGGG + Intergenic
923012166 1:230096479-230096501 AGGGGAAAGGGGAAGGAAGGCGG - Intronic
923022576 1:230176138-230176160 ATCGTTGATTGGAAGGAAGAAGG + Intronic
923189971 1:231611038-231611060 GTGGGAAAGTGGAAGGGAGTTGG - Intronic
923263484 1:232289733-232289755 ATAGGCAAGTGGAAGAAAGCAGG + Intergenic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
923601691 1:235409234-235409256 ATGTGTAATTGGTAGGCAGAAGG + Intronic
923961454 1:239088752-239088774 ATGGGAAAGTTGAAAAAAGAAGG - Intergenic
924497201 1:244601998-244602020 AAGGGGAAGGGGAAGGAAGGAGG + Intronic
924669680 1:246110836-246110858 ATTGGTAGGTGTAAGGAACATGG - Intronic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1064389109 10:14926109-14926131 ATGGGTATGAGGAAGGAAAGAGG - Intronic
1064798995 10:19047233-19047255 TTGGGTAATTGGACAGAAGAAGG + Intergenic
1065664537 10:28043468-28043490 ATGGGTAGGTTTGAGGAAGAAGG - Intergenic
1066023395 10:31325648-31325670 ATGGGGGAGGGGAAGGGAGAGGG - Intronic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067443430 10:46326202-46326224 ATGGATAAAAGGAAGGAACAGGG + Intronic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1068068062 10:52157797-52157819 AAAGGAAAGAGGAAGGAAGAAGG - Intronic
1068565370 10:58568779-58568801 GTGGGTTATTGGAAGAAAGAAGG + Intronic
1069085792 10:64138228-64138250 TTGGGTGAGTGAAAGGAAAAGGG + Intergenic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070624892 10:78043961-78043983 ATGCCTATGTGGAAGGGAGAGGG - Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070781575 10:79140556-79140578 ACAGGTAAGTGGATGGATGATGG - Intronic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072372902 10:94783402-94783424 AAGAGTAGGTGGATGGAAGAGGG + Intronic
1072388003 10:94951851-94951873 AAGAGTAGGTGGATGGAAGAGGG + Intronic
1072542508 10:96409174-96409196 ATGGATATGTGGATGGATGAGGG - Intronic
1073235263 10:102009247-102009269 ATTGGTAAGTGGTAGTAACAAGG - Intronic
1073281755 10:102359643-102359665 ATGGGCAATAGGAAGCAAGAAGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073873384 10:107892099-107892121 ATGAGAAAGTAGAAGGAAGCTGG - Intergenic
1073986674 10:109217502-109217524 ATGGGGTAGTGGAAGGAAGGGGG - Intergenic
1074162404 10:110845586-110845608 ATGGGTAGGGGGAGGGAAGGTGG - Intergenic
1074412841 10:113243042-113243064 ATGGATACGTGGAAGCAGGAGGG + Intergenic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075412303 10:122237563-122237585 ATTTATAAGTGGCAGGAAGAGGG - Intronic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1076290695 10:129343399-129343421 GTAGGGAGGTGGAAGGAAGATGG - Intergenic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1076910579 10:133386449-133386471 ATGGATATGTGGTTGGAAGAAGG + Intronic
1077163254 11:1123119-1123141 AGGGGGAGGGGGAAGGAAGAAGG - Intergenic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077599844 11:3566683-3566705 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1077876100 11:6307673-6307695 AAGGGAAATTGGATGGAAGATGG + Intergenic
1078035055 11:7794816-7794838 CTGGGTATGTGGAAGCAATAAGG + Intergenic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1079461407 11:20681932-20681954 AAGGGAAAATGGAAGGCAGAAGG - Intronic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1080737756 11:35033637-35033659 AGAGGTAAGTGGAAGAAAGCAGG - Intergenic
1080862070 11:36158495-36158517 CATGGTAAGTGGAACGAAGAGGG - Intronic
1080949584 11:37015749-37015771 ATGGATCAGTGGTAGAAAGATGG + Intergenic
1081282514 11:41227163-41227185 TATGGTAAGTGGAAGGAATAAGG - Intronic
1082895345 11:58184151-58184173 ATGGCTAAGGCCAAGGAAGATGG + Intergenic
1083197532 11:61097632-61097654 ATGGGCAGTTGGAAGAAAGATGG - Intergenic
1083724448 11:64620969-64620991 ATGAGTGAGTGTAAGGAGGAGGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084255753 11:67941304-67941326 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1084557229 11:69882308-69882330 TTGGGTCAGTGGATGGAAGCAGG - Intergenic
1084596322 11:70119011-70119033 ATGGGTGGGTGGATGGATGATGG + Intronic
1084596393 11:70119309-70119331 ATGGGTGGGTGGATGGATGATGG + Intronic
1084616811 11:70241907-70241929 GTGGGTAAGTGGATGGATGGAGG - Intergenic
1084705120 11:70811622-70811644 ATGGATGAGTGGATGGATGATGG - Intronic
1084781886 11:71415141-71415163 ATGGGTGAATGGATGGATGATGG + Intergenic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1084817005 11:71654023-71654045 ATGTGCAGGTGGAATGAAGAGGG + Intergenic
1084882041 11:72178267-72178289 AAGCGCAGGTGGAAGGAAGATGG + Intergenic
1085467413 11:76733686-76733708 ATGGGTGGATGGAAGGCAGATGG + Intergenic
1085484362 11:76849369-76849391 TTGGGTAAGACAAAGGAAGAAGG - Intergenic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1085967181 11:81541347-81541369 ATGGTTAAGTGGAAAAAACAAGG - Intergenic
1086220255 11:84434400-84434422 AATGATGAGTGGAAGGAAGAAGG + Intronic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1086974584 11:93117473-93117495 AAGGGAAAGTGGAAAGAAAAGGG - Intergenic
1087011346 11:93516948-93516970 AAGGGAAGGTGGAAGGCAGAGGG - Intronic
1087365802 11:97217400-97217422 AGGGGAAAGTGGAAGCAGGATGG - Intergenic
1087396617 11:97609145-97609167 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1087686976 11:101275996-101276018 AAGGGAAATTGGAAGGGAGAAGG + Intergenic
1087782853 11:102319398-102319420 ATGGTTATGTGAAAGGAAAAAGG + Intronic
1088120227 11:106360553-106360575 CTGGGTAACTGAAAGGATGATGG - Intergenic
1088398603 11:109397517-109397539 ATGGGCCAGTGGAAGGGAAATGG + Intergenic
1088700811 11:112409596-112409618 AAGAGTAGCTGGAAGGAAGATGG - Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089384144 11:118057025-118057047 AGTGGTGAGGGGAAGGAAGAAGG + Intergenic
1089396666 11:118140641-118140663 AAGGGGAAGGGGAGGGAAGATGG - Intronic
1089841953 11:121426187-121426209 ATGGGCAAGAGGAAGCAAGTAGG - Intergenic
1090634904 11:128685063-128685085 AAGGGAAAGAGAAAGGAAGAGGG + Intergenic
1090652765 11:128822153-128822175 AGGGGTGAGGGGCAGGAAGAGGG - Intergenic
1090658618 11:128864676-128864698 GAGGGTGAGTGGAAGGAAAAGGG + Intronic
1090729105 11:129554421-129554443 ATTGGAAACTGGAGGGAAGATGG + Intergenic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1092147854 12:6227146-6227168 ATGGGTAAGAGGATGGAACTGGG + Intronic
1092425993 12:8376042-8376064 ATGTGCAGGTGGAATGAAGAGGG - Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1094047377 12:26182558-26182580 AAGGGGAAGGGGAAGGGAGACGG - Intronic
1094090670 12:26645460-26645482 ATGGGTAAGTGTGGGGAACATGG + Intronic
1094260358 12:28490143-28490165 ATGAGAAAGGGGCAGGAAGATGG - Intronic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1095733978 12:45536112-45536134 ATGGGTAGGTGGAGAGCAGATGG - Intergenic
1095955394 12:47802921-47802943 ATGGGGCAGTGGGAGGAAAAGGG - Intronic
1096099613 12:48961832-48961854 TAGTGTATGTGGAAGGAAGAGGG - Intergenic
1096212679 12:49778489-49778511 ATTGGTAGGTGCATGGAAGAGGG - Intergenic
1096572519 12:52531851-52531873 ATGGGGAAGTGGATGTTAGAGGG - Intergenic
1096793292 12:54058460-54058482 ATGGCTAAGTAAAAAGAAGACGG + Intergenic
1098784420 12:74732582-74732604 ATGTGTGAGAGGAAGGAATATGG - Intergenic
1098829647 12:75345470-75345492 ATGGGTAAGTCTAGAGAAGAAGG - Intronic
1098839369 12:75460094-75460116 AAGGGTGAGGGGAAGGAAAATGG + Intergenic
1098969113 12:76830783-76830805 ATGTGTAAGTGGCAAGAAGCAGG + Intronic
1099117119 12:78641738-78641760 ATGATTAAGTGGAACAAAGATGG + Intergenic
1099212130 12:79804156-79804178 AGGGGTTATTGAAAGGAAGAAGG - Intronic
1099639206 12:85263021-85263043 ATGGGGAAGTGGCAAAAAGAAGG + Intronic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1101183178 12:102242248-102242270 ATGGGAGAGGGGAAGAAAGAAGG - Intergenic
1101201059 12:102436813-102436835 ATACATAAGTGGCAGGAAGAAGG + Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101694605 12:107113377-107113399 ATGGGTATTTGGGAGAAAGATGG - Intergenic
1102426243 12:112846521-112846543 ATGGGGAGGAGGGAGGAAGATGG + Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102504242 12:113373827-113373849 ATGGGTAGATGGATGGATGATGG - Intronic
1102506993 12:113390014-113390036 GTGGGTAAGTGGATGGAAAATGG - Exonic
1102796667 12:115694993-115695015 ATGGGAAAGTGGAAGGAACATGG - Intergenic
1102856099 12:116295468-116295490 ATGGGTAGATGGATGGAGGATGG + Intergenic
1102920783 12:116789776-116789798 ATGGGTAAATGGAAGGAGAGTGG + Intronic
1102920788 12:116789799-116789821 ATGGGTAAATGGAAGGAGAGTGG + Intronic
1102988423 12:117297376-117297398 TTGGGTAAGTGGAAGGATGGTGG + Intronic
1103834796 12:123809983-123810005 AGTGGTACGTGGTAGGAAGATGG - Intronic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1104778550 12:131405194-131405216 ATGGGTGGGTGGATGGATGATGG - Intergenic
1104813936 12:131635130-131635152 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104813964 12:131635300-131635322 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104896313 12:132166671-132166693 ATGGGTGAATGGATGGATGATGG - Intergenic
1104896432 12:132167125-132167147 ATGGGTGGGTGGATGGATGATGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105375666 13:19842196-19842218 GTGGGTTGGTGGAAGGAAGCTGG - Intronic
1105457135 13:20551424-20551446 ATGAGTAAGAGGAAGGGAGATGG + Intergenic
1106209428 13:27627771-27627793 ATGGGTGAGTGGAAGGAAACTGG + Intronic
1106370310 13:29126419-29126441 AGGGGTAAGTGGCAGTAAAATGG - Intronic
1106708434 13:32306279-32306301 ATGAGTAATTGGAAGAAAGAAGG + Intronic
1107037458 13:35916434-35916456 AAGGCTAATTGTAAGGAAGATGG - Intronic
1107342575 13:39423999-39424021 AAAGGCAAGGGGAAGGAAGAAGG + Intronic
1107377796 13:39823233-39823255 ATGGCAAAGTGGCAGGAAGTGGG - Intergenic
1107934977 13:45338641-45338663 ATGTGTAAGTACAAGGAAGTGGG - Exonic
1108331688 13:49391316-49391338 AGGGGGAAGAGAAAGGAAGATGG + Intronic
1108597419 13:51961379-51961401 ATGGCTGAGTGGAAAGAAAATGG - Intronic
1110397641 13:75049973-75049995 ATGTGCCAGTGGAAGGAAAAGGG + Intergenic
1110553488 13:76832348-76832370 ATGGATAAGTGGAAGAGAGAAGG - Intergenic
1111403639 13:87773021-87773043 AAAGGTAAGTGGAAGGAAGGAGG + Intergenic
1112414132 13:99190267-99190289 AGGTGTATGCGGAAGGAAGAAGG + Intergenic
1113195613 13:107801828-107801850 AGAGGAAAGGGGAAGGAAGAAGG - Intronic
1113392404 13:109910123-109910145 AAAGGTAGGTGGAAGGAAAATGG + Intergenic
1113447703 13:110382385-110382407 CTGGGGAAGTGGGCGGAAGACGG - Intronic
1113581600 13:111433970-111433992 TTAGGTAAGTGGAAAGAAGTGGG + Intergenic
1113855703 13:113444342-113444364 GGGGGTTAGTGGAAGGCAGATGG + Intronic
1114172630 14:20288920-20288942 ATGGGAAAATGGAAGAAAGCTGG + Exonic
1114382656 14:22224397-22224419 ATGGGAATGGGGAAGGGAGAAGG - Intergenic
1114427228 14:22634106-22634128 TTCTGCAAGTGGAAGGAAGAAGG - Exonic
1115703044 14:35974247-35974269 TTGAGTTAGTGGAAGGAACATGG + Intergenic
1116106928 14:40520637-40520659 AGGGGTTATTGGCAGGAAGAAGG - Intergenic
1116568041 14:46477145-46477167 ATCGGAAAGTGGAAGGTAGCAGG - Intergenic
1116779132 14:49216528-49216550 ATTGGTCAGAGGAAGGAATAAGG + Intergenic
1117164342 14:53018715-53018737 AAGGGTGAGTGGGAGGAAGAGGG - Intergenic
1117677521 14:58170072-58170094 ATGGGAGAGTGAATGGAAGAAGG + Intronic
1118354079 14:64997357-64997379 ATAGGGATGTGGAAGGAAGATGG - Intronic
1118466937 14:66039534-66039556 AAAGGTAAGTGAAAGGTAGATGG - Intergenic
1118986048 14:70755685-70755707 ATGGGTAAGCCTGAGGAAGAAGG + Intronic
1119144036 14:72294192-72294214 TTGCATAAGTGGGAGGAAGAGGG + Intronic
1119224926 14:72937763-72937785 AAGGGTAACAGGAAGGAAGTGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119997653 14:79271389-79271411 AAAGGGAAGGGGAAGGAAGAAGG - Intronic
1120132833 14:80826818-80826840 AAGAGTAAGTTGACGGAAGATGG + Intronic
1120911211 14:89668756-89668778 ATGGGGTAGTGGAATGAATAGGG - Intergenic
1121067200 14:90979286-90979308 AGGAAGAAGTGGAAGGAAGAGGG + Intronic
1121543584 14:94747052-94747074 ATGAATAAGTGGTAGGAAGGTGG + Intergenic
1121593317 14:95137346-95137368 AAGGGAAAGAGGAAGGAAAAGGG + Intronic
1121593367 14:95137500-95137522 AAGGGGAAGGGGAAGGAAAAGGG + Intronic
1121957907 14:98230858-98230880 ATGGAAGAGTGGAAGGAAGGTGG + Intergenic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1125580699 15:40783402-40783424 ATGGGTGAGAGGAAGGGAGGGGG + Intronic
1126683254 15:51224652-51224674 ATGACTAATTGGAAGGAAGCAGG - Intronic
1127360010 15:58237060-58237082 ATGGGTAAGTGGGTGGAGGGTGG + Intronic
1128237435 15:66077840-66077862 ATGGGTCAGTGGATGAAAGAGGG + Intronic
1128518924 15:68362576-68362598 ATGGATAAGTGGGTGGTAGATGG + Intronic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128784806 15:70386958-70386980 AGGGGGGCGTGGAAGGAAGAAGG + Intergenic
1128844931 15:70883984-70884006 ATGGGTGAGAGGTAGAAAGAAGG + Intronic
1129044981 15:72725982-72726004 AGGGGAAAGGGGAAGGGAGATGG - Intronic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130130404 15:81136359-81136381 AAGGGGAAGGGAAAGGAAGAAGG + Intronic
1130631586 15:85574808-85574830 ATGAGGAAGTGCAAGGAAGATGG - Intronic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130857734 15:87856092-87856114 AAGAGGCAGTGGAAGGAAGAAGG - Intergenic
1130978014 15:88792148-88792170 AAGGGGAAGTGCAAGGGAGATGG + Intergenic
1132054495 15:98639079-98639101 ATGAGTAAATGGATGGCAGATGG + Intergenic
1132386640 15:101405421-101405443 AGTGTTGAGTGGAAGGAAGATGG + Intronic
1132702359 16:1227256-1227278 ATGGGCCAGAGGGAGGAAGAAGG + Intronic
1133204757 16:4226651-4226673 AAGGGTGAATGGAAGGATGATGG + Intronic
1133372349 16:5254861-5254883 ATGTGTAGGTGGAGCGAAGAGGG + Intergenic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133652919 16:7829847-7829869 ATGGGTGAGTGGGTGGAAGGTGG - Intergenic
1134106984 16:11492310-11492332 ATGGGTGGGTGGATGGATGATGG - Intronic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134410082 16:13996479-13996501 ATGGATGAATGGAAGAAAGAAGG - Intergenic
1134770600 16:16806037-16806059 AGGGGGAAGGGGAAGGGAGAAGG - Intergenic
1134904840 16:17971506-17971528 AAGGGGAAGAGGAAAGAAGATGG + Intergenic
1134915918 16:18070879-18070901 ATGGATAGGTGGAAGTAAAATGG - Intergenic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135584110 16:23654746-23654768 AAAGGTAGGAGGAAGGAAGAGGG - Intronic
1135624375 16:23981991-23982013 AAGGGGAAGTGGAAGGGAAAAGG - Intronic
1135629368 16:24023780-24023802 ATGGGTAAGTGGAAGGTTGGGGG - Intronic
1135922475 16:26663564-26663586 AAGGGGAACTGGAAGGAAGGAGG + Intergenic
1135951688 16:26920158-26920180 ATTGGTAAAGGGCAGGAAGAAGG + Intergenic
1136135967 16:28257129-28257151 AAGGGTGGGTGGGAGGAAGATGG - Intergenic
1137712660 16:50577093-50577115 TTGGGTTGGTGGAAGGAATAGGG + Intronic
1137929627 16:52574666-52574688 ATAGGAAAGAGAAAGGAAGAAGG + Intergenic
1138408897 16:56822141-56822163 GTGGCTAGGAGGAAGGAAGAAGG + Intronic
1138458804 16:57135954-57135976 AAGGGGAAGGGGAAGGGAGAAGG + Intronic
1138926387 16:61596576-61596598 ATGAGAAAGTGGAAGGAAGTAGG - Intergenic
1139477927 16:67212178-67212200 ATGGGCAAGAGGTAGGGAGATGG - Intronic
1139629180 16:68217768-68217790 ATGGGAAAAAGGGAGGAAGAAGG + Intronic
1140195090 16:72848800-72848822 AAGGGAAAGAGGGAGGAAGAAGG - Intronic
1141421528 16:83920982-83921004 ATGGATGGGTGGAAGGAAGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141447638 16:84072301-84072323 AAGGGCTGGTGGAAGGAAGAAGG + Intronic
1141899308 16:86980104-86980126 ATGGGTAGGTAGAAAGAAAAAGG + Intergenic
1142099664 16:88264603-88264625 AGGGGGATGTGGGAGGAAGATGG - Intergenic
1142699625 17:1651089-1651111 ATGGGTAAGTGGGAGGAGCCTGG - Exonic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301459 17:5913692-5913714 ATGGGTGGATGGATGGAAGATGG - Intronic
1143645652 17:8228424-8228446 ATGGGTCCCTGGGAGGAAGAGGG - Intronic
1143688774 17:8542311-8542333 ATGGGGAGGTGGAGGGAAAATGG + Intronic
1143864702 17:9915742-9915764 ATGGGAAAGATGAAGAAAGATGG + Exonic
1144063243 17:11601788-11601810 ATGGGGAGGTGGAAGGAAAAGGG - Intronic
1144140263 17:12341206-12341228 ATGGGGATGTGGCAGGAAGCAGG + Intergenic
1144346328 17:14353267-14353289 ATGGGGAAGTTGAAGGACAAGGG + Intergenic
1144402636 17:14920985-14921007 ATTGGTAAATTGAAGGAAGATGG + Intergenic
1144993084 17:19247489-19247511 ATCCCTAAGTGGAAGGCAGATGG + Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145818476 17:27812589-27812611 TTGGGTATGTGGAAGGTAGCAGG - Intronic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148127147 17:45242715-45242737 GTGGGAAAGTGGAAGGAAAGAGG - Intronic
1148253048 17:46102722-46102744 TTTGTTAAATGGAAGGAAGAAGG - Intronic
1149242412 17:54665479-54665501 ATGGGTAGGTTGAAGAGAGAGGG + Intergenic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150859454 17:68786342-68786364 AGGGGTGAGAGGAAGGAAGGAGG - Intergenic
1151134704 17:71935051-71935073 ATGGATAAGTGGGAAGAAAAAGG - Intergenic
1151755600 17:76073840-76073862 ATGGGTAAGAGAAGGGAAAAAGG + Intronic
1152767126 17:82147729-82147751 ATGGGTGGGTGGATGGTAGATGG + Intronic
1152767251 17:82148191-82148213 ATGGGTGCGTGGATGGTAGATGG + Intronic
1152767366 17:82148577-82148599 ATGGGTGGGTGGATGGTAGATGG + Intronic
1152960026 18:74031-74053 AAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1153946359 18:10021564-10021586 GTGGGTAGGTGGGAGGTAGATGG - Intergenic
1153986750 18:10357553-10357575 ATGGTGAAGGGGAAGGAAGCAGG - Intergenic
1154155925 18:11944057-11944079 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1154475733 18:14755544-14755566 AGGGGTGAGGGGAAGGAAGGGGG - Intronic
1155397529 18:25402522-25402544 ATATGTAAGTGGATGGGAGAAGG - Intergenic
1155661062 18:28248795-28248817 ATAGGTAATTGGAAGGAGGAGGG + Intergenic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1156205555 18:34882289-34882311 AAGGGAGGGTGGAAGGAAGAAGG - Intronic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157331909 18:46710467-46710489 AAGGGGAAGGGGAAGGGAGAAGG - Intronic
1157786183 18:50485080-50485102 ATTGGAAAGTAAAAGGAAGAGGG - Intergenic
1157837471 18:50919451-50919473 ATAGGAAAGTGAGAGGAAGAAGG - Intronic
1157929873 18:51809825-51809847 ATTGCTAATTGGTAGGAAGAGGG + Intergenic
1158139156 18:54238982-54239004 ATGAGTAAGGGGAAGGAATGAGG - Intergenic
1158185402 18:54765709-54765731 ATGGGGAAAGGAAAGGAAGAAGG - Intronic
1158923935 18:62230333-62230355 TTGGGCAAGTGGAAGGATTATGG + Intronic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1160367811 18:78343771-78343793 TTGGGTAGGTAAAAGGAAGAAGG - Intergenic
1161227674 19:3154644-3154666 ATGGGTGGGTGGATGGATGATGG + Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161347723 19:3776504-3776526 ATGGGTATGTGGATGGATGATGG + Intergenic
1161370534 19:3908640-3908662 AAGGGGAAGGGGGAGGAAGAAGG - Intronic
1161449077 19:4334594-4334616 ATGGGTAAATGGTAGGTGGATGG - Intronic
1161449122 19:4334806-4334828 ATGGATGAGTGGATGGATGATGG - Intronic
1161449198 19:4335151-4335173 ATGAGTAGGTGGATGGATGATGG - Intronic
1161449213 19:4335220-4335242 ATGAGTAGGTGGATGGATGATGG - Intronic
1161657498 19:5525098-5525120 ATGGGTGAATGGATGGATGATGG - Intergenic
1161681420 19:5681551-5681573 ATGGATGAGTGGAAGGATGGGGG - Intronic
1161916060 19:7229115-7229137 ATGGGTGAGTGAATGGATGAAGG + Intronic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1161934564 19:7363728-7363750 ATGGGTGAAAGGAAGGAAGATGG + Intronic
1161934597 19:7363896-7363918 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1161934655 19:7364241-7364263 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1161934658 19:7364264-7364286 ATGGATAAATGAAAGGATGAAGG + Intronic
1162085825 19:8248597-8248619 ATGGGTAGGTGGATGGATGATGG + Intronic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1163058416 19:14740137-14740159 ATGGGAATGTGGAAGGTGGATGG + Intronic
1163108577 19:15142580-15142602 TTTGGTGTGTGGAAGGAAGATGG + Intergenic
1163158406 19:15451147-15451169 ATGGGTGAGTGGATGGGTGAGGG - Intergenic
1163295329 19:16408049-16408071 ATGGATAAGGGAAGGGAAGATGG + Intronic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163675807 19:18654726-18654748 ATGGGTAAGTGGGTGGAGGGAGG - Intronic
1164511862 19:28904109-28904131 ATGGGGAAGTGGAAGAAGAAAGG - Intergenic
1164678878 19:30120987-30121009 ATGGGTAGGTGGATGGATGATGG - Intergenic
1164680556 19:30131195-30131217 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1164721269 19:30433319-30433341 TTGGGGAAGTGGGGGGAAGATGG - Intronic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1165098346 19:33422693-33422715 ATGGGTAGATGGATGGTAGATGG - Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165190314 19:34057442-34057464 ATGGGTAGATGGATGGATGATGG + Intergenic
1166289556 19:41853693-41853715 ATAGCTAAGGGGAGGGAAGAAGG - Intergenic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167571135 19:50289893-50289915 ATGGTTTTGTGGGAGGAAGATGG - Intronic
1167598194 19:50438270-50438292 ATGGGTAGGTGGATGGATAACGG + Intronic
1167772959 19:51532090-51532112 CTGGGACAGTGAAAGGAAGAAGG + Intergenic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168592896 19:57651775-57651797 AAGGGAAAGTGGTAGGAAGACGG - Intergenic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925658846 2:6181321-6181343 ATGGGGAGGAGGGAGGAAGACGG - Intergenic
925715684 2:6782424-6782446 ACAAGTAAGTGGAAGGAATAAGG - Intergenic
925738571 2:6985469-6985491 ATGAGTAAGTGGAAGGATTAGGG + Intronic
926383580 2:12314794-12314816 ATGAGTTAGTGGAAGGAGCATGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
927474924 2:23405886-23405908 ATGGGTAGGTGTAAGGAAGAGGG + Intronic
927784581 2:25964874-25964896 ATGGGGAAGAGGGAGGAAGGAGG - Intronic
928220589 2:29399793-29399815 ATGTGAAAATGCAAGGAAGAAGG - Intronic
928902808 2:36338709-36338731 TTGGGTCAGAGGAAGGATGAAGG - Intergenic
928925829 2:36578341-36578363 GGATGTAAGTGGAAGGAAGAGGG - Intronic
929537760 2:42794082-42794104 ATGGGTGAGTGGGTGGATGAAGG + Intergenic
929554371 2:42916161-42916183 ATGGGATTGTTGAAGGAAGAAGG + Intergenic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930217223 2:48709142-48709164 AAGGGTAAGTGGAGGGAAAGTGG + Intronic
930967822 2:57353114-57353136 GTGGGTAGGTGGAAAGGAGAGGG - Intergenic
931364946 2:61611270-61611292 AAGGGTAAGAGAAAGGAAGAAGG + Intergenic
931502206 2:62881473-62881495 AAGGGGAAGGGGAAGGAAAAAGG + Intronic
931769261 2:65483739-65483761 TTGGGAAAGTGGGAGAAAGATGG - Intergenic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
931957783 2:67447393-67447415 GTGTCTAAGTGGAAGGGAGATGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932920398 2:75907656-75907678 AGAGGTAAGTGGTAGGAAGGAGG - Intergenic
933089728 2:78105751-78105773 GTGGGTAAGTGGCAGGTAGCTGG + Intergenic
933285137 2:80377248-80377270 ATGGATAAATGGAAGACAGATGG - Intronic
933426410 2:82118332-82118354 ATGGCAAACTGGAAGGAAGATGG + Intergenic
933809530 2:86024351-86024373 CTGGGGAGGTGGAAGGAATAGGG + Exonic
933835579 2:86242874-86242896 AAGAGTAAGTGGGAGGAAGGTGG + Intronic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934495796 2:94796728-94796750 AAGGGTGTGTGGAAGGCAGAAGG - Intergenic
935598548 2:104898976-104898998 ATTGGTGATTGGAAGGAAGGAGG + Intergenic
935865252 2:107380930-107380952 ATGGGTATTTCCAAGGAAGAAGG - Intergenic
936112442 2:109676162-109676184 ATGGGTATGGGGCTGGAAGAGGG - Intergenic
936245180 2:110820268-110820290 ATGGGAAAGAGGAAGTGAGAGGG + Intronic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936661897 2:114552086-114552108 ATGGTACAGTGGAAGGAACATGG + Intronic
936923984 2:117718141-117718163 GTGGGTACGTGTAAGTAAGAGGG + Intergenic
936924051 2:117718806-117718828 ATTGGTGAGGGGGAGGAAGAAGG - Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937279225 2:120705892-120705914 ATGGGTAAGTGCTGGGAAAAGGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937653370 2:124345829-124345851 TTGGGTAAATGTAAGCAAGAGGG - Intronic
939360835 2:141170486-141170508 ATGGCTAAGTAAAAGGAAGTGGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939614456 2:144346899-144346921 ATGTGTATGTGAAAGAAAGAGGG - Intergenic
940130940 2:150381004-150381026 CTGGCTAAGTGGAAGATAGATGG - Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940893008 2:159053727-159053749 CTGGGTAAGTGTTAGGAATAGGG + Intronic
941641596 2:167994922-167994944 TTGGGTAAGTAGAAGCCAGATGG + Intronic
941735143 2:168965959-168965981 ATGTGCAAGAGCAAGGAAGAGGG - Intronic
942035063 2:172002744-172002766 ATGGGTGAAAGGGAGGAAGAGGG - Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
943271339 2:185809722-185809744 GTGTGTAAGTGGAAAGAAAATGG - Intronic
943395720 2:187330076-187330098 AGAGGAAAGTGGAGGGAAGAGGG + Intergenic
943504044 2:188731168-188731190 GTGGTTCAGAGGAAGGAAGAAGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943656303 2:190512635-190512657 ATGGTTAAAGGGAAGGAAGAAGG + Intronic
943726528 2:191257034-191257056 AAGGGGAAGGGGGAGGAAGAGGG - Intronic
943748383 2:191486065-191486087 CTGGGAAATTGGAAGGAAAATGG + Intergenic
945476468 2:210287604-210287626 GTGGGTATGTGGCTGGAAGAGGG + Intergenic
945931905 2:215863856-215863878 ATGGGGCAGTGGAACTAAGAGGG - Intergenic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
948152003 2:235751879-235751901 ATACGTTAGTGGAGGGAAGAAGG - Intronic
948532004 2:238614926-238614948 ATGGATAAGTGGATGGATGGGGG - Intergenic
948815640 2:240509046-240509068 ATGGATGAGTGGAGGGTAGATGG + Intronic
1169178635 20:3542586-3542608 AGGGGGAAGGGGAAGGGAGAAGG - Intronic
1169477153 20:5941932-5941954 ATGGGTGCGTTGATGGAAGAAGG - Exonic
1169550833 20:6699595-6699617 AGGGGAGAGAGGAAGGAAGATGG - Intergenic
1169554743 20:6737232-6737254 ATGGAGATGTGGGAGGAAGAAGG + Intergenic
1170500566 20:16971889-16971911 AGAGAAAAGTGGAAGGAAGATGG - Intergenic
1171159650 20:22909594-22909616 ATGGGCAAGAGGATGGAACAGGG + Intergenic
1171227085 20:23451028-23451050 ATGGGTAAATGGATGGATGGGGG - Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171298889 20:24042124-24042146 ATGGGTGTGTGGAAAGAAGGTGG - Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1172089214 20:32415760-32415782 AAGAGTAAGGGGAAGGAAAAAGG - Intronic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1172771064 20:37382874-37382896 ATGGGGAAATGGGAGGCAGAGGG + Intronic
1172831140 20:37835952-37835974 ATGGGTTCGTGGAAGGAATATGG + Intronic
1172832865 20:37851061-37851083 ATGAGTAAGTGGCTGGAAGAGGG + Intronic
1172899076 20:38320931-38320953 ATGGGTAAGTGGATGGGAGGTGG + Intronic
1172899096 20:38320998-38321020 ATGGGTAAGTAGATGGGAGGTGG + Intronic
1173698403 20:45043844-45043866 AGGGGAAAGTGGAAGGAGGGAGG - Intronic
1175026708 20:55910248-55910270 AGGGGTGAGGGGAAGAAAGATGG + Intergenic
1175293672 20:57894659-57894681 AAGGGAAGGAGGAAGGAAGAAGG + Intergenic
1175513572 20:59552762-59552784 ATGGGCAATAGGAAGAAAGATGG + Intergenic
1175531229 20:59675112-59675134 AGGGGTAAGTGGAGGGGAGGAGG - Intronic
1175531249 20:59675168-59675190 AGGGGTAAGTGGAGGGGAGGAGG - Intronic
1175711146 20:61222056-61222078 ATGGGGAAGAGGAAGGCAGGAGG + Intergenic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1177069563 21:16486470-16486492 ATGGGTATGAGGAAGAGAGATGG + Intergenic
1177304213 21:19291733-19291755 ATGGGTAAGTCTAAATAAGAAGG - Intergenic
1178072447 21:28983674-28983696 ATGGCTAATTGAAAGGAGGAAGG + Intronic
1178278118 21:31257608-31257630 ATGGATTGATGGAAGGAAGATGG - Intronic
1178614030 21:34114627-34114649 TTGGGTAAGTCAAAGGAAAAGGG - Intronic
1178931060 21:36819781-36819803 ATGGGAAAGTGGAAAGAGTATGG - Intronic
1179400261 21:41076575-41076597 GTGGGCCAGAGGAAGGAAGAGGG - Intergenic
1179451993 21:41473958-41473980 GTGGGTAATTGAAAGGATGAGGG + Intronic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181783195 22:25207608-25207630 GTGGGTGGGTGGAAGGATGATGG - Intergenic
1182039081 22:27222380-27222402 ATGGGTGAATGGATGGATGATGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1183138248 22:35911219-35911241 ATGGGTTGGGGGAAGGGAGAAGG + Intronic
1183303966 22:37072144-37072166 ATGGGTGAATGGATGGATGATGG + Intronic
1183675191 22:39295164-39295186 ATGGGAAAGTGGAAGAAGGCAGG + Intergenic
1184191075 22:42894915-42894937 ATGGGCAAGGGGAGGGAAGGGGG + Intronic
1184254703 22:43280443-43280465 ATGGGTGAGGGGAAGGGACAGGG - Intronic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184444604 22:44539903-44539925 ATGGGTAGGTGGACGGTGGATGG + Intergenic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184753437 22:46502387-46502409 AGGGTAAAGTGGAAAGAAGAGGG + Intronic
1184753455 22:46502438-46502460 AGGGTAAAGTGGAAAGAAGAGGG + Intronic
1184950463 22:47838592-47838614 ATGGGTAAATGGAACAAGGAAGG + Intergenic
1184993171 22:48184183-48184205 ATGGGTTAATGGAAGAAAGAAGG - Intergenic
1185053601 22:48566514-48566536 ATGGGTGAGTGGAAAGATGAAGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
950031772 3:9858514-9858536 TTGGCTAAGTGGAAAGATGAAGG - Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950573508 3:13816770-13816792 ATGGGTAGATGGATGGATGAAGG - Exonic
950750785 3:15126470-15126492 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
951035584 3:17928353-17928375 AAGAATAAGTGTAAGGAAGAAGG + Intronic
951220275 3:20061138-20061160 AGGGGTTGGAGGAAGGAAGAGGG - Intronic
952307669 3:32160308-32160330 ATGGGTGAATGGATGGATGATGG + Intronic
952307703 3:32160427-32160449 ATGGGTGAATGGATGGATGATGG + Intronic
952307733 3:32160533-32160555 ATGGGTGAATGGATGGATGATGG + Intronic
952392544 3:32892764-32892786 AGGGTTAAATGGAAGGAAAAAGG + Exonic
952716364 3:36484560-36484582 ATGGGTAAGTGGACCTCAGAGGG - Intronic
953366917 3:42352947-42352969 TTTGGGAAGTGGAAGGAACATGG + Intergenic
953531157 3:43740830-43740852 ATGGTTAAGTGGATTGATGATGG - Intergenic
954745781 3:52786878-52786900 ATGGATAGGTGAAAGGATGAGGG + Intronic
955237124 3:57149383-57149405 ATGGGTAAGTACAGAGAAGAAGG - Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956989372 3:74745454-74745476 ATAGGAAAGAGGAAGGAAGAAGG - Intergenic
957070663 3:75565342-75565364 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
958833545 3:99117654-99117676 TTGGGCAATAGGAAGGAAGAAGG + Intergenic
959674851 3:109022990-109023012 AAAGGGAACTGGAAGGAAGAAGG + Intronic
959689955 3:109187947-109187969 AAGGGAGAGAGGAAGGAAGAAGG + Intergenic
960664083 3:120093891-120093913 ATGGGTAGGAGGGAGGGAGAGGG + Intronic
960972967 3:123152189-123152211 ATGGGTAGGTGGAAGACAGGTGG - Intronic
961283433 3:125781225-125781247 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
961735237 3:128997277-128997299 ATGGGGAAGGGGCAAGAAGAAGG - Intronic
962202708 3:133414406-133414428 AGGGGTAAGTAGAGGGGAGAGGG - Intronic
962202743 3:133414526-133414548 AGGGGTGAGTAGAAGGGAGAGGG - Intronic
962203019 3:133415625-133415647 ACGGGTAAGTAGAGGGGAGAGGG - Intronic
962203054 3:133415766-133415788 AAGGGTAAGTGGAGGGGAGATGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203383 3:133417114-133417136 AGGGGTAAGTAGAGGGGAGAAGG - Intronic
962203630 3:133418107-133418129 AGGGGTGAGTAGAAGGTAGAGGG - Intronic
962849292 3:139295853-139295875 ATGGAAAGGTGGAAGGGAGAAGG - Intronic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963310870 3:143708753-143708775 ATGGGTACATGGAATGGAGATGG - Intronic
963623555 3:147642395-147642417 AGGGGAAAGTGGAAGAAAAATGG + Intergenic
963853004 3:150226433-150226455 TTGGGTAAGAGGAAGGAAAGAGG + Intergenic
964028306 3:152105038-152105060 ATGGAAAAGAGGAAGGAAAAGGG - Intergenic
964118650 3:153161168-153161190 TTGGGGAAGTGGGAGGCAGAGGG + Intergenic
964500997 3:157348018-157348040 GTGGCTAGGTGGAATGAAGATGG - Intronic
965853727 3:173063351-173063373 ATGCAAAAGTGGAAAGAAGAAGG + Intronic
966555205 3:181251364-181251386 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
966762735 3:183431596-183431618 ATGGGTGAGAGGAAGGGAGAAGG - Intergenic
967937901 3:194743846-194743868 AGAGGGAAGTGGAAGGTAGAGGG - Intergenic
968123361 3:196141662-196141684 AGGGGAAAGAGGAAAGAAGAAGG + Intergenic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
969014279 4:4093008-4093030 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
969065298 4:4474638-4474660 ATGTGGAAGTGGGAGGCAGAAGG + Intronic
969489645 4:7491780-7491802 TTGGGTAAGTGGGAGGGTGAGGG + Intronic
969501608 4:7556808-7556830 ATGGGTAGATGGATGGATGATGG - Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969612300 4:8234220-8234242 ATGGGTGAATGGATGGATGATGG - Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
969739691 4:9015404-9015426 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
971110379 4:23578439-23578461 ATGGTACAGTGGGAGGAAGATGG + Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
971276117 4:25198577-25198599 ATGGGGAAGTGGGAGGCATAAGG + Intronic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972665291 4:41159263-41159285 ATAGGAAACAGGAAGGAAGAAGG + Intronic
972778673 4:42266286-42266308 ATGGGTGGGGGGAAGGAAGGTGG - Intergenic
972990874 4:44821510-44821532 ATGGGTAGTAGGAAGAAAGATGG + Intergenic
973277743 4:48327462-48327484 ATGGGTAACTGGAAGGGAAATGG - Intergenic
973319434 4:48794982-48795004 ATGGGAGAGGGGAAGGAAGCAGG - Intergenic
974030771 4:56774303-56774325 AGTTATAAGTGGAAGGAAGAAGG - Intergenic
974188897 4:58476647-58476669 AGAAGAAAGTGGAAGGAAGAAGG + Intergenic
974321170 4:60352514-60352536 ATGGGGTGGGGGAAGGAAGAAGG - Intergenic
974508502 4:62807493-62807515 ATGGTCAAGTGGAAGCAAGGTGG + Intergenic
974556595 4:63459529-63459551 AAGGGGAAGTGGAAGGAAACTGG + Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975704195 4:77095640-77095662 ATGGGGGAGTGGAATGAAGTGGG + Intergenic
975983963 4:80186333-80186355 GTAGGTAAGTGGAAAGAGGAAGG - Intronic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
976259033 4:83128423-83128445 AAGGGAAAGGGGAAGGAAGGAGG - Intronic
977164167 4:93674913-93674935 ATAAGTAAATGGATGGAAGAGGG + Intronic
977856315 4:101898844-101898866 ATGGGTGGGTGGAAATAAGAGGG + Intronic
978891166 4:113829742-113829764 GAGGGAAAGTGGAAGGAATATGG + Intergenic
978927037 4:114259333-114259355 ATGGGTAAGTGCAATGATGAGGG + Intergenic
979677845 4:123429196-123429218 TAGGGTAAGTGGAGGGAAGATGG + Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980323301 4:131307360-131307382 ATTGGAGAGTGGAAGGAAGGTGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
981616885 4:146651806-146651828 AGGGGAAAATGGAAGGAGGAAGG - Intergenic
982759301 4:159261824-159261846 ATAGGTGAGTGGGAGGTAGAAGG - Intronic
983009648 4:162531344-162531366 ATGGGTAAGTGCAAAGAACTGGG + Intergenic
984278011 4:177633717-177633739 ATGGGGAATTGGAAAGGAGATGG - Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984835321 4:184014249-184014271 AAGGGTATGTAGAAGGAAAAAGG + Intronic
985913465 5:2900583-2900605 AGGGGAAGGTGGAAGGGAGAAGG - Intergenic
985993802 5:3585033-3585055 ATGGGAGAAAGGAAGGAAGAAGG + Intergenic
986756378 5:10840137-10840159 TTTGGAAAGTGGAGGGAAGAAGG + Intergenic
986761023 5:10879750-10879772 ATGGATAAATGGAAGGAGTAGGG - Intergenic
987111212 5:14688756-14688778 TTGGGTTAGTGGAAGGCTGACGG + Intronic
988841055 5:35084451-35084473 ATAGGTAAGGGGAAGGAAAGTGG - Exonic
989295842 5:39825642-39825664 AAGAGTAAGTGGAAGGATAAAGG + Intergenic
989785967 5:45329961-45329983 ATATGTAATTGGAAAGAAGATGG - Intronic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990934396 5:61132289-61132311 ATGAATAAGTGAAAGAAAGAGGG + Intronic
991146531 5:63312550-63312572 AGGGGTATGTGGAAGGAAATAGG + Intergenic
993044630 5:82853474-82853496 ATGGGTGATTGGAAGGAGGCAGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993467601 5:88268230-88268252 ATGGCTAAGTGTAAAGAATAAGG + Intronic
995142661 5:108749793-108749815 AGGGGTAACTGTAAGGCAGAAGG - Intronic
996290263 5:121844402-121844424 TTGGGTCTTTGGAAGGAAGACGG - Intergenic
996452571 5:123642233-123642255 AGGGGAAAGTGAAATGAAGAAGG + Intergenic
996471536 5:123866987-123867009 ATGGCAAAGTGGAATGTAGAAGG + Intergenic
996491142 5:124098929-124098951 AGAGGTAAGCTGAAGGAAGAAGG + Intergenic
996872674 5:128208971-128208993 TTGGGTATGTGGCAGGAGGAAGG - Intergenic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
997281548 5:132651150-132651172 CTGGGTAAGTGGAGGGGATATGG + Intergenic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
997802095 5:136873733-136873755 AAGGGTAAGTTAAAAGAAGAGGG + Intergenic
997803198 5:136887839-136887861 AAGGGAAAGAGGAAGAAAGAGGG - Intergenic
998511553 5:142718449-142718471 ATGGGTAAATACAAGGAAGCTGG + Intergenic
998793756 5:145794620-145794642 ATCTGTAAGAGGAAGGAAGCAGG + Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999046364 5:148474080-148474102 ATGAGTCAGTGGAAGGAACTAGG - Intronic
999672981 5:153973917-153973939 ATGAGGACATGGAAGGAAGAGGG - Intergenic
1000109681 5:158095943-158095965 GTGGGGGAGTGGAAAGAAGATGG + Intergenic
1000233718 5:159338315-159338337 GTGGGCAACTGGAAGGAAGTGGG + Intergenic
1000263864 5:159616247-159616269 ATGAGTGAGTGGAAAGAATAAGG - Intergenic
1000371212 5:160538379-160538401 ATGAGTACGTAGAAGGAAAATGG - Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000865978 5:166515235-166515257 ATGGGGAGGTGGGAGGTAGAAGG - Intergenic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001751445 5:174134588-174134610 ATGGGTGAATGGATGGATGATGG - Intronic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002875268 6:1204404-1204426 TTGGGTCAGTGGATGGAAAATGG + Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003683211 6:8276142-8276164 ATGGGTATATGGCGGGAAGAGGG + Intergenic
1003788695 6:9517213-9517235 ATTGGCAGGTGGAAAGAAGAAGG - Intergenic
1004458404 6:15813113-15813135 ATGGGCAGGTGGACGGAACATGG + Intergenic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1005273301 6:24189329-24189351 AGTGGTAAGGGGAAAGAAGATGG + Intronic
1005447746 6:25942033-25942055 AAGGGAATGTGCAAGGAAGAGGG + Intergenic
1005495387 6:26383494-26383516 AGGGGGAAGTGGAGGGACGAGGG + Intronic
1006061109 6:31420064-31420086 ATGGGTAGGTGGCAGAAATAGGG + Intergenic
1006181421 6:32155383-32155405 ATGGGTAACAGGAAGCAAAAGGG - Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006557872 6:34884418-34884440 AAGGGTATATGGAAGGATGAAGG + Intronic
1007002218 6:38324667-38324689 AAGGGTACGTGGGAGGAAAAGGG + Intronic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007196135 6:40062326-40062348 ATTGGCAACTGCAAGGAAGAGGG - Intergenic
1007636643 6:43303739-43303761 AGGGTGATGTGGAAGGAAGAAGG - Intronic
1009481932 6:64169878-64169900 GGGGCTAAGTGTAAGGAAGAAGG + Intronic
1009797307 6:68487338-68487360 AGTGGTTAGTGGAAAGAAGATGG - Intergenic
1010316050 6:74451988-74452010 ATGGGGAGCTGGAAGGAAAATGG - Intergenic
1010365716 6:75049269-75049291 ATAGGCAAGGGGATGGAAGAAGG - Intergenic
1010559501 6:77332818-77332840 ATGGGAAAGTGGGAAGGAGATGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1012123096 6:95391489-95391511 ATGGGTGAGTGAAGGGATGAAGG + Intergenic
1012145509 6:95675638-95675660 ATGGATAAGAGGATGAAAGAAGG - Intergenic
1012420200 6:99056479-99056501 GTGGGTAGGAGGGAGGAAGATGG + Intergenic
1012462064 6:99474761-99474783 ATGAGTAAGAGGGAGGAAAATGG + Intronic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1013180473 6:107713162-107713184 ATGGGCATGTGTAAGGCAGAGGG - Intronic
1013615027 6:111834855-111834877 ATAGGAATGAGGAAGGAAGAAGG - Intronic
1014002475 6:116380259-116380281 ATGTCTAGGTGGAGGGAAGAGGG + Intronic
1014719688 6:124901025-124901047 ATGAGCAAATGGAAAGAAGATGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015458350 6:133456967-133456989 ATGGGTAAGTTGAAGAAGCAAGG - Intronic
1015715952 6:136191966-136191988 GCAGGTAAGTGGGAGGAAGATGG - Exonic
1015722097 6:136253198-136253220 ATTGGTATGTGGAAGGAACAAGG - Intergenic
1016374039 6:143402325-143402347 ACGGGAAAGTGGGGGGAAGAGGG + Intergenic
1016630169 6:146220619-146220641 ATGGGTAAGAGGAAGGAAAAAGG - Intronic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1017634549 6:156431077-156431099 AAGGGTAAGTTGAGGGAAGATGG - Intergenic
1017782233 6:157724502-157724524 AAGGGTCAGTGGTTGGAAGAGGG - Intronic
1018298663 6:162376854-162376876 AGGGGAAAGGGGGAGGAAGAGGG + Intronic
1018379737 6:163247760-163247782 ATGGGACAGTGGCAGGTAGACGG - Intronic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1019092653 6:169552248-169552270 ATGGCTAAACGGAAGGAAGTGGG - Intronic
1019567252 7:1690425-1690447 ATGGGTGAATGGATGGATGAAGG + Intronic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019567328 7:1690785-1690807 ATGGGTGAATGGATGGATGAAGG + Intronic
1020607199 7:10354413-10354435 ATGGGGGAGTGGTAGGAAGGTGG - Intergenic
1020934748 7:14448472-14448494 ACTGGAAAGTGGAAGGCAGATGG + Intronic
1021053772 7:16021393-16021415 ATGGAAAAGTGAAAGGTAGAAGG + Intergenic
1021928919 7:25560591-25560613 ATGGTTAAGTAGAAGCCAGAGGG - Intergenic
1022405902 7:30089608-30089630 ATGAGCAAATGTAAGGAAGATGG + Intronic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1023135063 7:37043156-37043178 AGTGGTAATTGGAAGGGAGAAGG - Intronic
1023245720 7:38201423-38201445 GTGGGTTTGTGGAAGGAAAAAGG + Intronic
1023662279 7:42482070-42482092 ATGTGTAAGTTGAAGGAAACAGG - Intergenic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1023980953 7:45069674-45069696 TTGGGTCAGTGAAAGGCAGAGGG + Intronic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1026645964 7:72169124-72169146 ATGTGTAAATGTAGGGAAGAAGG - Intronic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027471387 7:78578634-78578656 AAGGGAAAGAGAAAGGAAGAAGG + Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027768739 7:82379848-82379870 AAGGGTAAGAGAAAGAAAGATGG - Intronic
1028428011 7:90712601-90712623 ATGGGAAAGGGCAAGGAATAAGG + Intronic
1028584609 7:92440301-92440323 AAGGGAAAGGGGAAGGAAGGAGG + Intergenic
1028713179 7:93934387-93934409 AGGGGTGGGTGGAAGGCAGAGGG - Intergenic
1028831986 7:95338225-95338247 ATAGCTAATTGGAAGGAAGCTGG - Intergenic
1029072946 7:97914646-97914668 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029953598 7:104613602-104613624 AGGGGTGAGTGGAGGGTAGATGG - Intronic
1031291224 7:119938427-119938449 TTGGGTAAGAGGAAAGAATAAGG - Intergenic
1031874593 7:127123872-127123894 AAGGGAAAGGGAAAGGAAGAAGG - Intronic
1032450736 7:132028800-132028822 AGGGGTCAGTGAAAGGAACATGG - Intergenic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1032725212 7:134584556-134584578 ATGGATAAATGGATGGAAGCAGG + Intergenic
1032979301 7:137263736-137263758 ATGGGTAGTAGGAAGAAAGATGG + Intronic
1033218033 7:139508301-139508323 ATGAATTTGTGGAAGGAAGAAGG + Intergenic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1034975478 7:155446856-155446878 AAGGGGAAGGGGAAGGAAAAGGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1036244734 8:7106623-7106645 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
1036255999 8:7207093-7207115 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1036361488 8:8080406-8080428 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1036806911 8:11841371-11841393 ATGGCTCAGTAGATGGAAGAAGG - Intergenic
1036889490 8:12586617-12586639 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1036897090 8:12644809-12644831 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1036961700 8:13251224-13251246 TGGGGTAAGTGGAAGGTATAAGG - Intronic
1037107215 8:15123947-15123969 TTGGGCAAGAGGAAGAAAGAGGG + Intronic
1037344413 8:17883787-17883809 AAGGGGAAGGGGAAGGAAAAGGG - Intronic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037548274 8:19944959-19944981 AAGGGGAAGGGGAAGGAAGGAGG - Intronic
1037745110 8:21637054-21637076 AAGGGTAAATGGAAGAATGAGGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038027483 8:23605052-23605074 AGGGGGAAATGGTAGGAAGAGGG + Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038663418 8:29516846-29516868 ATGGATAGGAGGAAGGAAGGAGG + Intergenic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1038757920 8:30359209-30359231 TTGGGTAATTGGAAGGAAGAGGG - Intergenic
1039273327 8:35907078-35907100 AAGGGTATGTGTAAGGAACATGG - Intergenic
1039317282 8:36387721-36387743 AGGGGAAAATGGGAGGAAGAAGG - Intergenic
1039344276 8:36686774-36686796 ATGAGTCAGTGTAAGAAAGAAGG - Intergenic
1039379117 8:37068263-37068285 GAGGGTAAGTGGAAGGAATGTGG - Intergenic
1040546445 8:48401633-48401655 AGGGGTAGGAGGAAGGAGGAGGG + Intergenic
1041095078 8:54342027-54342049 ATTGGCATGTGGAAGGAAGAAGG + Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1041552031 8:59113731-59113753 ATGGGTAACTGGGAAGGAGATGG + Intronic
1042162157 8:65907497-65907519 ATAGGTAGGTTGAAGGAAAAAGG - Intergenic
1042615812 8:70647760-70647782 AGGGTGAAGTGGAAGGAAGGTGG + Intronic
1043179385 8:77067310-77067332 ATGGGTAGGTGAGAGGAAAAAGG - Intergenic
1043186931 8:77164395-77164417 ATGGGGAAGTGGGAGGGAAATGG + Intergenic
1044011754 8:87002712-87002734 AAGGGTAAGAGGGATGAAGAAGG - Intronic
1045083999 8:98660808-98660830 ATGGGAAAGTGAAGAGAAGAGGG - Intronic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045527263 8:102951780-102951802 ATTGGGAAGGGGAAGGGAGAGGG - Intronic
1045944259 8:107777621-107777643 ATGGGGAAGTTGAGGGAAAATGG - Intergenic
1046126074 8:109910226-109910248 AAGGGAAAGGGGAAGGGAGAGGG - Intergenic
1046701720 8:117408153-117408175 ATATATAAGTGGAAGGAAAAAGG + Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1046791698 8:118329159-118329181 ATAGATGAGTGGAAGGAACATGG + Intronic
1047403212 8:124563048-124563070 AGTGGTAAGAGGAAGGAGGAAGG + Intronic
1047413344 8:124642433-124642455 GTGGGTGATTGGCAGGAAGATGG - Intronic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1048055522 8:130859362-130859384 TTGTGTAAGTGGATGGCAGATGG - Intronic
1048167593 8:132077138-132077160 ATGGATAAGTGGAAGGAAAGAGG + Intronic
1048445735 8:134491702-134491724 ATGGGGAAGAGGAAGGCAGTAGG - Intronic
1048774605 8:137932059-137932081 ATGTGTAAGGGAAAGGAAGCAGG - Intergenic
1049130973 8:140840482-140840504 ATGTGTAAGTTGGAAGAAGATGG + Intronic
1049155292 8:141062534-141062556 ATGGGGAAGTGGAGGGATCATGG + Intergenic
1049248974 8:141578116-141578138 ATGGGAAAGTGGAAGAAATGGGG + Intergenic
1049348396 8:142151241-142151263 ATGGATAAGTGGATGGGTGATGG + Intergenic
1049349122 8:142154652-142154674 ATGGTAAAGTGGAAGGAAGCTGG + Intergenic
1049350562 8:142162246-142162268 ATGGGTAAATGGATAGAGGATGG + Intergenic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049372044 8:142272585-142272607 ATGGGTGGGTGGATGGAAGGAGG - Intronic
1049374966 8:142285074-142285096 ATGGGTAGATGAAAGGATGATGG + Intronic
1049464124 8:142743439-142743461 ATGGGTAAATGAATGGGAGATGG + Intergenic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1051716181 9:19987136-19987158 ATTGGAATGTGGAAGGAAGATGG + Intergenic
1052075962 9:24140914-24140936 ATGGGTGAATGGTAGGATGACGG - Intergenic
1053113574 9:35482539-35482561 ATGGGGAAGGGAAAAGAAGATGG + Intergenic
1053487468 9:38470766-38470788 ATGAATAAGTGGATGGATGAAGG - Intergenic
1053661343 9:40283653-40283675 AGGGGTGTGTGGAAGGCAGAAGG + Intronic
1053911718 9:42912999-42913021 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054373462 9:64429871-64429893 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054454363 9:65421971-65421993 GTGGATGAGTGGATGGAAGATGG + Intergenic
1054459143 9:65453312-65453334 ATGGGTAAAGGGAAGGATGTGGG + Intergenic
1054523267 9:66092631-66092653 AGGGGTGTGTGGAAGGCAGAAGG - Intergenic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055237703 9:74143876-74143898 ATGGGAATGGGGAAGGGAGATGG - Intergenic
1055550955 9:77431819-77431841 AAGGGTGAGTGGGAGGGAGAAGG - Intronic
1056236159 9:84596879-84596901 ATGGGTAAGTAGAAGCTAGAGGG - Intergenic
1056678647 9:88697830-88697852 AGAGGAAAGGGGAAGGAAGACGG - Intergenic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057914146 9:99042915-99042937 ACGGGTCAGTGGACGAAAGATGG - Intronic
1058137671 9:101325375-101325397 ATGGGTAGGCTGAAGGTAGAGGG - Intergenic
1058533354 9:105929174-105929196 GTGTGTAAGTGGATAGAAGAAGG + Intergenic
1059252230 9:112895801-112895823 ATGGGTAGATGGATGGATGATGG - Intergenic
1059650991 9:116315719-116315741 AGGAGTAAGAGGAAGAAAGATGG + Intronic
1060040925 9:120300282-120300304 ATGAGTCAGTGGATGGATGATGG + Intergenic
1060404137 9:123364770-123364792 ATGGTGAAGAGGAAGGGAGATGG - Intronic
1061226747 9:129284882-129284904 ATGGGTAACTGCAGAGAAGAGGG + Intergenic
1061244707 9:129395492-129395514 ATGGGTGAATGAATGGAAGATGG + Intergenic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061584468 9:131557009-131557031 TGGGGTGAGTGGATGGAAGATGG - Intergenic
1061607843 9:131724900-131724922 ATGGGTAAGCACAAGGCAGATGG - Intronic
1061635492 9:131905849-131905871 CTGGGTAGATGGGAGGAAGAAGG - Intronic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062275229 9:135727335-135727357 ATGGGAAAGAGGGAGAAAGAGGG - Intronic
1062362608 9:136194757-136194779 AAGGGGAAGGGGAGGGAAGAGGG - Intergenic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1062738052 9:138149558-138149580 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185664144 X:1751179-1751201 CTGGGTAAGTGGGAAGAACAGGG + Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186254987 X:7708686-7708708 ATGGGCAGGTGAAAAGAAGAAGG - Intergenic
1187480180 X:19648235-19648257 ATGGGTAGGTGGAAGGAAGGAGG + Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1189050677 X:37642009-37642031 CTGGATAAGTGGAAGAAATAGGG + Intronic
1190286725 X:48966405-48966427 ATGGGCAAGGGAAGGGAAGAGGG - Intronic
1190324764 X:49199817-49199839 AGGGGAGAGTGGAAGGAAGATGG - Intronic
1190420982 X:50284185-50284207 AGGGGGAAGAGAAAGGAAGATGG - Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190792816 X:53715849-53715871 ATGGCTAAGTGGTAGGACCAAGG - Intergenic
1190932675 X:54962601-54962623 ATTGGGGAGAGGAAGGAAGAGGG + Intronic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192065300 X:67879019-67879041 TAAGGTAAGTGGAAGGAGGAAGG + Intergenic
1192226458 X:69231515-69231537 ATGGGGGAGTGGAAGGCAGGTGG + Intergenic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1192538634 X:71949819-71949841 CTTGGTATGTGGAAGGCAGAGGG - Intergenic
1192589723 X:72349941-72349963 ATGGCAGAGTTGAAGGAAGAAGG + Intronic
1192611931 X:72575331-72575353 ATTGGTGAGAGGGAGGAAGATGG + Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193789562 X:85801328-85801350 AATGGAAAGTTGAAGGAAGAAGG - Intergenic
1194518857 X:94893652-94893674 ATTGGTGGCTGGAAGGAAGAAGG - Intergenic
1194552633 X:95320340-95320362 ATGGCTAAGTGGAATGCTGAGGG - Intergenic
1194787846 X:98108369-98108391 ATGTGTAAGTCTAAGGAAAAGGG + Intergenic
1195002598 X:100656462-100656484 AGGGGTAAGTGGGTGGCAGAGGG - Intronic
1195457888 X:105090016-105090038 ATGGGAGAGAGTAAGGAAGAGGG + Intronic
1196024804 X:111030563-111030585 ATGGGTGGGTGGATGGATGAAGG + Intronic
1196322677 X:114360707-114360729 GTGGGAAAGTGGAGGGGAGATGG + Intergenic
1196405566 X:115358909-115358931 ATAGGTAAGAGGAAAGAAAATGG + Intergenic
1196596835 X:117555470-117555492 ATGGGTAAGTGGTACCATGATGG + Intergenic
1197166300 X:123381340-123381362 AAGGGTCAGTGGTAGGAAGATGG - Intronic
1197881454 X:131171021-131171043 ATGGGTGAGGGAAAGCAAGAAGG - Intergenic
1197959389 X:131987751-131987773 TTGGGGAAGTGGGAGAAAGATGG - Intergenic
1198970421 X:142272723-142272745 ATGGGTAGTAGGAAGAAAGATGG - Intergenic
1199036122 X:143052996-143053018 TTTGGAAAGGGGAAGGAAGAGGG - Intergenic
1199507749 X:148585177-148585199 ATGGGTAGGTGAAAGGAACCAGG + Intronic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199741672 X:150741458-150741480 ATGGGGTAGGGGAAGGAACAGGG - Intronic
1202234144 Y:22690690-22690712 AAGGGAGAGAGGAAGGAAGAAGG + Intergenic
1202309014 Y:23505476-23505498 AAGGGAGAGAGGAAGGAAGAAGG - Intergenic
1202561786 Y:26165112-26165134 AAGGGAGAGAGGAAGGAAGAAGG + Intergenic