ID: 1027534922

View in Genome Browser
Species Human (GRCh38)
Location 7:79386822-79386844
Sequence GATCAGTGACCTTATATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 595}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027534916_1027534922 23 Left 1027534916 7:79386776-79386798 CCTTTGGGAAGATGACTAAGTAA 0: 1
1: 0
2: 2
3: 20
4: 190
Right 1027534922 7:79386822-79386844 GATCAGTGACCTTATATGAGAGG 0: 1
1: 1
2: 6
3: 79
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027534922 Original CRISPR GATCAGTGACCTTATATGAG AGG Intronic
901182218 1:7349669-7349691 GACCGGTCACCTTATATAAGAGG - Intronic
901291385 1:8126885-8126907 GATGAGTGTCCTTCTATAAGAGG + Intergenic
902734030 1:18388218-18388240 GATTAGTGCCCTTATAAAAGAGG + Intergenic
903558868 1:24212804-24212826 GATTAGTGCCCTTATAAAAGAGG + Intergenic
904352846 1:29920228-29920250 GATTAGTGTCCTTATAACAGTGG + Intergenic
904850317 1:33454464-33454486 GATCAGTGTCCTTATAAAAAGGG + Intergenic
904924837 1:34039319-34039341 GATCACTGACCTTGGATAAGGGG - Intronic
905372236 1:37489075-37489097 GATTAGTGTCCTTATAAAAGAGG + Intergenic
905530656 1:38676112-38676134 GATTAGTGCCCTTATAAAAGAGG - Intergenic
905916998 1:41691517-41691539 GATTAGTGCCCTTATAAAAGAGG + Intronic
906651850 1:47518338-47518360 GATTAGTGCCCTTATAAAAGAGG + Intergenic
907446639 1:54512354-54512376 GATTAGTGCCCTTATAAAAGAGG - Intergenic
907869435 1:58430024-58430046 GATTAGTGCCCTTATATAAGAGG - Intronic
908064786 1:60391016-60391038 GATTAGTGCCCTTATAAAAGAGG + Intergenic
908554640 1:65245594-65245616 GATTAGTGACCTTATAAAAGAGG - Intergenic
908584811 1:65556097-65556119 GATTAGTGCCCTTATAAAAGAGG + Intronic
908810249 1:67974949-67974971 GATTAGTGCCCTTATAAAAGAGG - Intergenic
909122768 1:71625487-71625509 GATGAGTTAAATTATATGAGAGG + Intronic
909417216 1:75420058-75420080 GATTAGTGTCCTTCTAAGAGAGG + Intronic
909933673 1:81527403-81527425 GATTAGTGTCCTTATAAAAGCGG + Intronic
910266455 1:85342963-85342985 TATAAGTGACCTTAAATTAGTGG - Intronic
910445869 1:87298587-87298609 GATCAGTGCCCTTATAAAAGAGG + Intergenic
911020796 1:93385882-93385904 GATTAGTGACCTTATAAAACAGG + Intergenic
911314464 1:96339389-96339411 GATTAGTGCCCTTATAAAAGAGG - Intergenic
911377542 1:97069565-97069587 GATTAGTGCCCTTATAAAAGAGG - Intergenic
911631219 1:100185635-100185657 GATTAGTGTCCTTATAAAAGAGG - Intergenic
911904175 1:103545684-103545706 GATTACTGACATTAAATGAGAGG + Intronic
911994427 1:104746387-104746409 GATTAGTGTCCTTATAAAAGTGG + Intergenic
912392266 1:109311615-109311637 GAGCAGTGACCCTCAATGAGGGG + Exonic
912666439 1:111584493-111584515 GATTAGTGCCCTTATAAAAGAGG - Intronic
912841257 1:113041556-113041578 GATTAGTGGCCTTATAAAAGAGG - Intergenic
915887699 1:159740859-159740881 GATTACTGACCTTATAAAAGGGG - Intergenic
916323816 1:163534896-163534918 GATGTGTGACCTTAGGTGAGTGG - Intergenic
916523237 1:165584727-165584749 GATTAGTGCCCTTATAAAAGAGG + Intergenic
916629068 1:166592363-166592385 GATTAGTGATCTTATAAGAGAGG - Intergenic
917605347 1:176622987-176623009 GATTAGTGCCCTTATAAAAGAGG - Intronic
917757526 1:178117625-178117647 GATTAGTGCCCTTATAAAAGGGG + Intronic
918028217 1:180775025-180775047 GATTAGTGACGTTATAAAAGAGG - Intronic
918191981 1:182184531-182184553 CATGAGCTACCTTATATGAGAGG - Intergenic
919428144 1:197459547-197459569 GATTGGTGACCTTATAAAAGAGG - Intronic
919484928 1:198134242-198134264 GATTAGTGCCCTTATAAAAGAGG + Intergenic
920582574 1:207125533-207125555 GATTAGTGCCCTTATAAAAGAGG + Intronic
920725008 1:208426791-208426813 GATTAGTGTCCTTATAAGAGAGG - Intergenic
922277621 1:224093626-224093648 GATGAGTGCCCTTATAAAAGAGG + Intergenic
922501402 1:226099396-226099418 GATTAGTGACCTTATAAGAAAGG - Intergenic
923358213 1:233181788-233181810 GATCAGTGTCCTTGTAAAAGAGG - Intronic
923404844 1:233649684-233649706 GATTAGTGCCCTTATATCAGAGG - Intronic
923656217 1:235919341-235919363 GACCACTGACCTCCTATGAGGGG - Intergenic
924415637 1:243853415-243853437 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1063419276 10:5898339-5898361 GATTAGTGCCCTTATAAGAGAGG - Intronic
1063728879 10:8672539-8672561 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1065710571 10:28513169-28513191 GATTAGTGTCCTTATAAAAGAGG + Intergenic
1065758774 10:28962013-28962035 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1066298518 10:34076603-34076625 GATTAGTGGCCTTATAACAGAGG + Intergenic
1066558879 10:36646687-36646709 AAACAGTGACCATCTATGAGTGG + Intergenic
1067221238 10:44345834-44345856 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1068909341 10:62361543-62361565 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1069243859 10:66176648-66176670 GATTAGTGCCCTTATAAAAGAGG + Intronic
1069337994 10:67375947-67375969 GATCAGTGCTCTTATAAAAGAGG + Intronic
1069587703 10:69619548-69619570 GATTAGTGCCCTTATAAGAGAGG - Intergenic
1069598654 10:69688967-69688989 GATCAGAGCCCAGATATGAGAGG - Intronic
1070583566 10:77743441-77743463 GATCAGCGCCCTTATAAAAGAGG + Intergenic
1070963388 10:80514870-80514892 GATGAGTGTCCTTATGTAAGAGG + Intronic
1071300322 10:84251716-84251738 GATTAGTGCCCTTATAAGAAGGG - Intronic
1071305328 10:84294470-84294492 GATCAGTGCCCTTCTAAAAGAGG + Intergenic
1072597894 10:96892561-96892583 GATTAGTGCCCTTATAAAAGAGG - Intronic
1072716385 10:97755540-97755562 GATTAGTGCCCTTATAAAAGAGG - Intronic
1073386688 10:103131475-103131497 GATTAGTGCCCTTATAAAAGAGG + Intronic
1073747134 10:106481869-106481891 GGTCAGTGATATTATCTGAGAGG + Intergenic
1073874039 10:107900572-107900594 CATCAGTAAAATTATATGAGGGG - Intergenic
1073955357 10:108864525-108864547 GATCAATGCCCTTATAAAAGAGG + Intergenic
1074431963 10:113401862-113401884 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1074689476 10:115991419-115991441 GATTAGTGCCCTTATAAAAGGGG - Intergenic
1075312188 10:121423672-121423694 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1075580727 10:123616158-123616180 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1077993588 11:7433651-7433673 GATTAGTGCCCTTATAAAAGAGG + Intronic
1078258881 11:9685559-9685581 GATCAATGACCTTATAAAAGAGG - Intronic
1078908968 11:15713247-15713269 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1079345627 11:19649583-19649605 GATCAGTGCACTTATAAAAGAGG - Intronic
1080231538 11:30021774-30021796 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1080593024 11:33740007-33740029 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1080743947 11:35091031-35091053 GATTAGTGTCCTTATAAAAGAGG + Intergenic
1080762838 11:35269104-35269126 GATCAGTGACCTCAGAAAAGAGG + Intronic
1081465036 11:43308700-43308722 GATTAGTGCCCTTATACAAGAGG - Intergenic
1081795957 11:45819788-45819810 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1081825120 11:46042725-46042747 GATTAGTGTCCTTATAAAAGAGG + Intronic
1082782538 11:57299009-57299031 GATTAGTGCCCTTATAAGAGAGG + Intergenic
1085446025 11:76601473-76601495 GATCAGTGTCCTGACAAGAGAGG + Intergenic
1085736344 11:79042446-79042468 GATTAGTGACCTTATAAAAGAGG + Intronic
1085802077 11:79599997-79600019 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1086307195 11:85494071-85494093 GATTAGTATCCTTATATAAGGGG - Intronic
1087082784 11:94187757-94187779 GAACACTGGCATTATATGAGGGG - Intergenic
1087512454 11:99114966-99114988 GATTAGTGCCCTTATAGAAGAGG + Intronic
1087603488 11:100345329-100345351 GATCAATGCCCTTATAAAAGAGG - Intronic
1087978312 11:104578296-104578318 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1088758364 11:112906272-112906294 GATTAGTGACCTTATAAAATAGG + Intergenic
1089212846 11:116817693-116817715 GATTAGTGTCCTTATAAAAGAGG - Intergenic
1089604338 11:119633111-119633133 GATTAGTGCCCTTATAAAAGAGG + Intronic
1089851597 11:121501831-121501853 TATCAGTGACCTTTTGTGACTGG + Intronic
1089897197 11:121942485-121942507 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1090200927 11:124855639-124855661 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1090883993 11:130860359-130860381 GATGAGTGCCCTCATAAGAGGGG + Intergenic
1093190685 12:16071293-16071315 GATTAGTGACCTTATGAAAGAGG + Intergenic
1093241533 12:16682726-16682748 GATTAGTGTCCTTATAAAAGAGG + Intergenic
1093794675 12:23297335-23297357 GATTAGTGACCTTATAAAAGAGG - Intergenic
1094442867 12:30498629-30498651 GATTAGTGTCCTTATAAAAGAGG + Intergenic
1095748706 12:45687833-45687855 TAGCAGTAAGCTTATATGAGGGG - Intergenic
1095814296 12:46404711-46404733 AATTAGTGCCCTTATAGGAGAGG + Intergenic
1096292681 12:50354476-50354498 GATCTGTGCTCTCATATGAGAGG + Exonic
1096349035 12:50878911-50878933 GATTAGTGCCCTTATATGAGAGG + Intronic
1097623091 12:61965207-61965229 GATTAGTGACCTTATAAAAGAGG + Intronic
1097630429 12:62055091-62055113 GATCAATGCCCTTATAAAAGAGG + Intronic
1097640175 12:62171558-62171580 GATTAGTGTCCTTATAAAAGAGG + Intronic
1098032647 12:66270240-66270262 GATCACTGAATTTATATGAAAGG + Intergenic
1098094590 12:66941417-66941439 CAACAGTGACCTTATAAAAGGGG - Intergenic
1098136877 12:67412509-67412531 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1098345393 12:69497487-69497509 GATTAGTGCCCTTATAAAAGAGG - Intronic
1099432140 12:82600056-82600078 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1099438479 12:82671068-82671090 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1099482314 12:83183289-83183311 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1099532819 12:83806932-83806954 CATTAGTGACGTTATTTGAGAGG + Intergenic
1099753867 12:86814740-86814762 GATGAGTGCCCTTATAAAAGAGG + Intronic
1100400088 12:94221814-94221836 GATTAGTGTCCTTATAGAAGAGG - Intronic
1100406567 12:94277232-94277254 GATTAGTGCCCTTATAAAAGAGG - Intronic
1100747295 12:97660485-97660507 GATTAGTGTCCTTATAAAAGAGG - Intergenic
1100984653 12:100192410-100192432 GATCAGGGTCCTTATAGAAGAGG + Intergenic
1101332828 12:103770896-103770918 GATTAGTGCCCTTATAATAGAGG + Intronic
1101468252 12:104970215-104970237 GATTAGTGTCCTTATGTAAGAGG + Intergenic
1102407346 12:112685245-112685267 GATTAGTGCCCTTATAAAAGAGG - Intronic
1102734154 12:115143145-115143167 GATTAGTGTCCTTATAAGAAGGG + Intergenic
1103426771 12:120842687-120842709 GATTAGTGCCCTTATAAAAGAGG - Intronic
1105456889 13:20549215-20549237 GATTAGTGCCCTTATGAGAGTGG + Intergenic
1106374887 13:29176646-29176668 GATTAGTGAACTTATAAAAGAGG - Intronic
1107043153 13:35969872-35969894 GATTAGTGACCTTATAAAAGAGG + Intronic
1107176515 13:37405801-37405823 GATTAGTGCCCTTATAAGAGAGG - Intergenic
1107601920 13:42022556-42022578 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1107603521 13:42037689-42037711 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1107999511 13:45893512-45893534 GATTAGTGACCTTATAAAAGAGG - Intergenic
1108601681 13:52000359-52000381 GATTAGTGCCCTTATAAAAGAGG - Intronic
1109232993 13:59781870-59781892 GATTAGTGGCCTTATAAAAGAGG + Intronic
1110241260 13:73269855-73269877 AATCAGTGACCTTATAAAAGAGG + Intergenic
1110360948 13:74624982-74625004 GATCAGTGACCTTATAAAAGAGG - Intergenic
1110413906 13:75231791-75231813 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1110417068 13:75264708-75264730 GATTAGTGCCCTTATCAGAGAGG - Intergenic
1110603311 13:77401615-77401637 GATCAGTGCCCTTATGAAAGAGG - Intergenic
1110685068 13:78362823-78362845 GATCAGTGCCCATATAAAAGAGG - Intergenic
1110744712 13:79038981-79039003 GATTAGTGTCCTTATAAGAAAGG - Intergenic
1110832272 13:80045065-80045087 GATTAGTGTCCTTATAAGAAGGG + Intergenic
1110844232 13:80175671-80175693 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1111117629 13:83801739-83801761 GATTAGTGCCCTTATAAGGGAGG + Intergenic
1111816660 13:93162537-93162559 GATTAGTGTCCTTACATGAGAGG - Intergenic
1111978268 13:94990307-94990329 TATAAGTGTCCTTATAAGAGAGG - Intergenic
1112262870 13:97893712-97893734 GATTAGTGACCTTATAAAATAGG - Intergenic
1112414594 13:99193724-99193746 GATCAGTGCCCTTATAAAAGAGG - Intergenic
1112608107 13:100927885-100927907 TATCAGTGTCCTTATAAAAGTGG - Intergenic
1112657471 13:101467081-101467103 GATTAGTGCCCTTATAAAAGAGG - Intronic
1113017235 13:105841248-105841270 GATCAGCGTCCTTATAGAAGGGG - Intergenic
1113131801 13:107045276-107045298 GATGAGTGAGCTTATAAAAGAGG + Intergenic
1115229143 14:31139347-31139369 GATTAGTGTCCTTATAAAAGAGG + Intronic
1115996462 14:39200829-39200851 GATTCGTGACCTTATAAAAGAGG - Intergenic
1116127719 14:40809427-40809449 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1116942004 14:50799587-50799609 CATCAGTGAGCTGATGTGAGAGG + Intronic
1117160644 14:52986214-52986236 GATCAGTGTCCTTAGAAAAGAGG - Intergenic
1117224373 14:53639466-53639488 GATTAGTGCCCTTATAAGAGAGG + Intergenic
1117573915 14:57078536-57078558 GATTAGTGCCTTTATAAGAGGGG + Intergenic
1117831175 14:59752367-59752389 AATTAGTGACCTTATAAAAGTGG - Intronic
1118029317 14:61804921-61804943 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1118049936 14:62015654-62015676 GATGAGTGCCCTTATAAAAGAGG + Intronic
1118068282 14:62216387-62216409 GATTAGTGTCCTTATAAAAGAGG + Intergenic
1118367919 14:65111246-65111268 GATAAGTGCCCTTATAAAAGAGG + Intergenic
1120501960 14:85308458-85308480 GATTAGTGCCCTTATAAGAAGGG + Intergenic
1121303540 14:92890477-92890499 GATTAGTGCCCTTATAAGAGAGG + Intergenic
1121383063 14:93491143-93491165 GATTAGTGCCCTTATAAAAGAGG - Intronic
1122160386 14:99780125-99780147 GATTAGTGACCTTATAAAAAGGG - Intronic
1122185202 14:99987332-99987354 GATTAGTGTCCTTATAAAAGAGG + Intronic
1122304704 14:100755554-100755576 GATCAGTGTCCTTATAAAATAGG - Intergenic
1124075297 15:26438262-26438284 GATTAGTGTCCTTATAATAGGGG - Intergenic
1124200448 15:27674580-27674602 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1124372488 15:29111550-29111572 GATCAGTCACCATCTCTGAGTGG + Intronic
1124706766 15:31973047-31973069 GATTACTGCCCTTATATAAGGGG - Intergenic
1125217261 15:37289605-37289627 GATCAGTGCCCTTATGAAAGAGG - Intergenic
1126260802 15:46688402-46688424 TATAAGTGTCCTTATATGAGAGG - Intergenic
1126363461 15:47870148-47870170 GATTAGTGCCCTTATACAAGAGG + Intergenic
1126462046 15:48924723-48924745 GCCCAGTGACCTTCAATGAGTGG - Intronic
1126878955 15:53073961-53073983 GATTAGTGACCTTATAAAAGAGG + Intergenic
1127303984 15:57684099-57684121 GATTAGTGGCCTTATGAGAGAGG - Intronic
1127457072 15:59164940-59164962 GATTAGTGACCTTACAGAAGAGG + Intronic
1127564086 15:60169469-60169491 GATTAGTGACCTTATAAAAGAGG - Intergenic
1127984663 15:64060572-64060594 GATTAGTGCCCTTATAAAAGAGG - Intronic
1130009798 15:80141929-80141951 GAACAATGCCCTTAGATGAGAGG + Intergenic
1130121229 15:81049300-81049322 GATCAGCGCCCTTATAAAAGAGG + Intronic
1131372370 15:91893521-91893543 GATTAGTGCCCTTATAACAGAGG - Intronic
1131683649 15:94749325-94749347 GATTAGTGCCCTTATAAAAGGGG - Intergenic
1131752808 15:95527592-95527614 GATTAGTGACCTTATAAAACAGG - Intergenic
1131841696 15:96444116-96444138 GATCAGTGCCCTTAGAAAAGAGG - Intergenic
1132418244 15:101640283-101640305 GATTAGTGCCCTTATAGAAGAGG + Intronic
1133451615 16:5908860-5908882 GATTAGTGTCCTTATAGAAGAGG + Intergenic
1133830230 16:9316247-9316269 GATTAGTGTCCTTATAAAAGAGG - Intergenic
1135833544 16:25800783-25800805 TATTAGTGACCTTATAGGAGGGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1138346252 16:56322093-56322115 GGTTAGTGCCCTTATAAGAGAGG - Intronic
1138434860 16:56991982-56992004 GACCGGTGTCCTTATAAGAGAGG + Intronic
1139054177 16:63161521-63161543 GATCTGTGCCCTTATAAAAGAGG - Intergenic
1139137878 16:64226469-64226491 GATCGGTGCCCTTATAAAAGAGG + Intergenic
1140334830 16:74095499-74095521 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1140681922 16:77393557-77393579 GATGAGTGCCCTTATAAAAGAGG + Intronic
1140721394 16:77775528-77775550 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1141162345 16:81637944-81637966 GATCAGTGCCCTTAGAAAAGAGG - Intronic
1141417096 16:83884092-83884114 GATCAGCGTCCTTATAAAAGAGG + Intergenic
1141535856 16:84679191-84679213 GATTAGTGCCCTTATAAGAAAGG + Intergenic
1141777459 16:86133871-86133893 GATCAGTGCCCTTGTAAAAGAGG + Intergenic
1141906603 16:87030824-87030846 GATTAGTGCCCTTATAAAAGCGG - Intergenic
1143782383 17:9236005-9236027 GATTAGTGTCCTTATATAAGAGG - Intronic
1144287295 17:13789272-13789294 GATCAGTGCCCTTATAAAAGAGG + Intergenic
1148217395 17:45840496-45840518 GGTCAGTGCCCTCACATGAGTGG - Intergenic
1148981692 17:51581925-51581947 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1150477705 17:65487477-65487499 ATTCAGTGCCCTTATAAGAGAGG - Intergenic
1150609064 17:66718630-66718652 GATTAGTGCCCTTATAAAAGAGG - Intronic
1151248074 17:72811283-72811305 GATTAGTGCCCTTAAAAGAGAGG - Intronic
1151532736 17:74717496-74717518 GATTAGTGCCCTTATAAGAAAGG + Intronic
1152869351 17:82743692-82743714 GATCAGTGACATTATCTGCCTGG - Intronic
1152917278 17:83047252-83047274 GATTAGTGCCCTTATAAAAGAGG - Intronic
1153273029 18:3341973-3341995 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1153512794 18:5873767-5873789 GACCAGTGTCCTTATATGAAGGG + Intergenic
1154000535 18:10478595-10478617 GATTAGTGCCCTTATAAAAGAGG - Intronic
1155006013 18:21729794-21729816 GATTAGTGCCTTTATAAGAGAGG - Intronic
1155043199 18:22082295-22082317 GATCAGTGCCCTTACAAAAGGGG - Intergenic
1155229729 18:23760915-23760937 GATAAGTGCCCTTATAAAAGAGG - Intronic
1155749973 18:29410050-29410072 AATTAGTGACCTTATAAAAGAGG - Intergenic
1156071984 18:33222564-33222586 GATTAGTGCCCCTATAAGAGAGG - Intronic
1156195517 18:34770026-34770048 GATTAGTGCCCTTATAAAAGAGG - Intronic
1156524771 18:37756505-37756527 GATGAGTGCCCTTATAAAAGAGG + Intergenic
1156597419 18:38563481-38563503 CATCAGGGAGCATATATGAGTGG - Intergenic
1156950695 18:42893463-42893485 GATGAGTGCCCTTATAAAAGAGG - Intronic
1157125985 18:44956432-44956454 TTTCAGTGACTTTATCTGAGTGG + Intronic
1157390489 18:47298322-47298344 GATTAGTGTCCTTATAAGAAGGG + Intergenic
1157533011 18:48438280-48438302 GATCAGTGCCCTTACAACAGAGG + Intergenic
1157806996 18:50665596-50665618 GATCAGTGCCCTTCTATGTGGGG - Intronic
1157818862 18:50750905-50750927 GATTAGTGCCCTTATTAGAGAGG + Intergenic
1157911394 18:51620334-51620356 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1159003944 18:62996456-62996478 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1159980708 18:74776148-74776170 GATTAGTGTCCTTATAAGAAAGG + Intronic
1161770438 19:6228006-6228028 CATCAGTGTCCTTAGATGAAAGG - Intronic
1163295153 19:16406921-16406943 GATTAGTGGCCTTATAAAAGAGG + Intronic
1163296981 19:16418745-16418767 GATTAGTGCCCTTATAAAAGAGG + Intronic
1163360063 19:16840283-16840305 GATTGGTGTCCTTATAAGAGAGG + Intronic
1165253989 19:34561983-34562005 GATGAGTGCCCTTATAAAAGAGG - Intergenic
1165275315 19:34745912-34745934 CATCAGTGACCTTCAATGACAGG - Intergenic
1165704763 19:37967561-37967583 GACCAGTGTCCTTATAAGAAGGG - Intronic
1165728354 19:38128218-38128240 GATCAGTGCCCATATAAAAGAGG - Intronic
1166570836 19:43796092-43796114 GATTAGTGCCCTTATAAAAGAGG - Exonic
1166582902 19:43918454-43918476 GATTAGTGCCCTTATAAAAGAGG + Intronic
1167151024 19:47709855-47709877 GATCTGTGAACTTAGATGTGGGG - Intergenic
1167447794 19:49548737-49548759 GATCAGTGAGCTGAGATCAGTGG - Intergenic
925241048 2:2328492-2328514 GATTTGTGACCACATATGAGTGG - Intronic
925423969 2:3733693-3733715 GATTAGTGTCCTTATAAAAGAGG - Intronic
925468995 2:4138765-4138787 GATTAGTGCCCTTATATAAGAGG + Intergenic
925533388 2:4889426-4889448 GATCAGAGCCCTTATAAAAGAGG - Intergenic
925759628 2:7171880-7171902 GACCAGTGACCTTAGAGGAGAGG + Intergenic
926110339 2:10178837-10178859 GATTAATGCCCTTATAAGAGAGG + Intronic
926886476 2:17603377-17603399 GATTAGTGCCCTTATAAAAGAGG - Intronic
927204145 2:20596427-20596449 GATTAGTGACCTTATAAAAGAGG + Intronic
927746419 2:25625900-25625922 GATTAGTGCCCTTATAAAAGAGG + Intronic
928411722 2:31059528-31059550 GATTAGTGCCCTTATAAGAGAGG + Intronic
928765962 2:34645937-34645959 GATTAGTGACTTTATAAAAGAGG - Intergenic
928771482 2:34707166-34707188 AATTAGTGTCCTTATATAAGAGG + Intergenic
929633192 2:43487688-43487710 GATTAGTGCCCTTATAAAAGAGG + Intronic
929735866 2:44548587-44548609 AAGCAGTGACATTATCTGAGTGG + Intronic
929831131 2:45347387-45347409 GATCATTGCCCTTATAAAAGAGG - Intergenic
930207429 2:48602108-48602130 GATTAGTGCCCTTATAAAAGAGG - Intronic
930337129 2:50062288-50062310 GATTAGTGCCCTTATAAAAGAGG + Intronic
931139559 2:59442330-59442352 AATCAGTGCCCTTATAAAAGAGG + Intergenic
931260626 2:60615289-60615311 GATTAGTGCCCTTATAAAAGAGG - Intergenic
931889469 2:66655255-66655277 GATTAGTGCCCTTATAAGAAAGG - Intergenic
932362256 2:71118641-71118663 GATTAGTGTCCTTATAAAAGAGG - Intronic
933038558 2:77431335-77431357 GATTAGTGCCCTTATAACAGAGG - Intronic
933238374 2:79890926-79890948 GATTAGTGCCCTTATAAAAGAGG - Intronic
933993765 2:87652503-87652525 GATCAGTGCCCTTATAAAAGAGG - Intergenic
934872846 2:97883100-97883122 GATTAGTGACCTTACAAGAGAGG - Intronic
935179594 2:100677608-100677630 GATCAGTGCCCTTATAAAAGAGG - Intergenic
935581941 2:104763419-104763441 GATTAATGACCTTATAAGAAGGG + Intergenic
935623208 2:105146435-105146457 GATTAGTGCCCTTATAAAAGAGG - Intergenic
935802568 2:106713672-106713694 GCTCAGGGACCTCATATAAGTGG - Intergenic
936300098 2:111298380-111298402 GATCAGTGCCCTTATAAAAGAGG + Intergenic
936406815 2:112212205-112212227 GATTAGTGCCCTTATAAAAGAGG - Exonic
936687808 2:114848998-114849020 GATTAGTGCCCTTATAAAAGAGG - Intronic
936707129 2:115088126-115088148 GATTAGTGCCCTTATAAAAGAGG - Intronic
936896380 2:117432549-117432571 GATTAGTGCCCTTGTATGAGAGG - Intergenic
936948524 2:117953669-117953691 GATGAGTGCCCTTATAAAAGAGG + Intronic
937420272 2:121748331-121748353 GATTAGTGACCTTATAAAAGAGG + Intronic
937847887 2:126601537-126601559 GATTAGTGCCCTTATAAAAGAGG - Intergenic
937901567 2:127023702-127023724 GATTAGTGTCCTTATAAGAAGGG - Intergenic
938109822 2:128556431-128556453 GATTAGTGCCCTTATAAAAGAGG + Intergenic
938118986 2:128620685-128620707 GATCAGTGCCCTTACAAAAGAGG + Intergenic
938568576 2:132542016-132542038 GATTAGTGCCCTTATAGAAGAGG - Intronic
938706290 2:133930527-133930549 GATTAGTGTCCTTATAAAAGAGG - Intergenic
938945051 2:136204815-136204837 GATTAGTGTCCTTATAAAAGAGG - Intergenic
939243991 2:139599310-139599332 GATTAGTGCCCTCATAAGAGAGG - Intergenic
939575307 2:143888060-143888082 GACCACTGTCCTTATAAGAGAGG + Intergenic
939871747 2:147533693-147533715 GATTAGTGTCCTTATAAAAGAGG - Intergenic
940041984 2:149370445-149370467 GATTAATGACCTTATATAAGAGG + Intronic
940413430 2:153392884-153392906 GATTAGTGCCCTTATAAAAGAGG + Intergenic
940493817 2:154399518-154399540 GATTAGTGCCCTTATAAAAGAGG - Intronic
940902764 2:159141259-159141281 GATTAGTGACCTTATAAATGAGG - Intronic
941083735 2:161092243-161092265 GATTAGTGGCCTTATAAAAGGGG - Intergenic
941304223 2:163841482-163841504 GATCAGTGACTTTATTTATGTGG + Intergenic
942471596 2:176266651-176266673 GATTAGTGTCCTTATAAAAGAGG + Intergenic
942534625 2:176950058-176950080 GATTAGTGCCCTTATAAAAGAGG + Intergenic
942718234 2:178919039-178919061 GATTAGTGACCTTATGAAAGAGG + Intronic
943186288 2:184611161-184611183 GATTAGTGCCCTTATAGAAGAGG - Intronic
943195618 2:184744443-184744465 GATTAGTGCCCTTATAAAAGAGG + Intronic
943642635 2:190375961-190375983 GATTAGTGCCCTTATAAAAGGGG + Intergenic
944378789 2:199081624-199081646 CACAAGTGACCTTATATGAGAGG - Intergenic
944636489 2:201680435-201680457 GATTAGTGCCCTTATAAAAGAGG - Intronic
944814277 2:203359732-203359754 GATTAGTGCCCTTATAAAAGAGG - Intronic
946331527 2:219011975-219011997 GATTAGTGCCCTTATAAAAGAGG + Intronic
946437930 2:219671179-219671201 GATTAGTGGCCTTATAAAAGAGG - Intergenic
947995640 2:234524934-234524956 GATTAGTGTCCTTATAAAAGTGG + Intergenic
948582962 2:239000369-239000391 GATCAGTGCCCTTAAAAAAGAGG - Intergenic
1168788409 20:559284-559306 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1169331407 20:4719345-4719367 GATTAGTGCCCTTATAATAGAGG - Intergenic
1169594565 20:7183237-7183259 GATCAGTGCCCTTATAAAAGAGG + Intergenic
1170075085 20:12410438-12410460 GATTCGTGCCCTTATAAGAGAGG + Intergenic
1170542264 20:17401415-17401437 GATTAGTGCCCTTATAAAAGAGG - Intronic
1170562037 20:17566957-17566979 GATTAGTGCCCTTATAAAAGAGG - Intronic
1170671524 20:18438866-18438888 GATTAGTGCCCTTATAAGAGAGG - Intronic
1170743861 20:19081092-19081114 GATCAGTGCCCTCATAAAAGAGG - Intergenic
1171221184 20:23399349-23399371 GATGAGTGCCCTTATAAAAGAGG + Intronic
1171302670 20:24077544-24077566 TATCAATGTCCTTATATGACAGG + Intergenic
1173678665 20:44860599-44860621 GATCAGTGGCTTTATAAAAGAGG - Intergenic
1175916669 20:62429168-62429190 GATCAGTGTCCTTCTACAAGCGG + Intergenic
1176923465 21:14717977-14717999 GATTAGTGCCCTTATACAAGGGG - Intergenic
1177197048 21:17914310-17914332 GATTAGTGCCCTTATAAAAGAGG - Intronic
1177326468 21:19596060-19596082 GATTAGTGACCTTAGAAAAGAGG + Intergenic
1177472381 21:21575754-21575776 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1177499496 21:21934018-21934040 GATCAGTGTCCTTATAAAAGAGG + Intergenic
1177502637 21:21977953-21977975 GATTAGTGCCCTTATATAAGAGG - Intergenic
1177802364 21:25840414-25840436 GATTAGTGCCCTTATAAAAGGGG - Intergenic
1178033187 21:28551640-28551662 GATCAATGCCCTTATAAAAGAGG - Intergenic
1178168233 21:30007505-30007527 GATTAGTGACCTTATAAAAGAGG - Intergenic
1178483988 21:33005500-33005522 GATTAGTGCCCTTATAAGAAGGG + Intergenic
1178512067 21:33213852-33213874 GATTAGTGCCCTTATAAGAAGGG - Intergenic
1179161152 21:38900477-38900499 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1179219597 21:39394693-39394715 GATTAGTGCCCTTATAAAAGAGG - Intronic
1181003950 22:20000745-20000767 GATCAGTGTCCTTATCAAAGCGG + Intronic
1181886330 22:26025009-26025031 GATTAGTGCCCTTATAAAAGAGG - Intronic
1184520160 22:44988966-44988988 GATTAGTGCCCTTATAAAAGAGG - Intronic
1184622589 22:45693511-45693533 GATTAGTGCCCTTATAAAAGGGG - Intronic
1184722885 22:46325655-46325677 GATCTGTGCCCTTATAAAAGAGG - Intronic
949329432 3:2905455-2905477 GATTAGTGCCCTTATAAAAGAGG - Intronic
949589879 3:5483026-5483048 GATTAGTGACCTTATAAAAGAGG - Intergenic
950471248 3:13187890-13187912 GATTAGTGTCCTTATAAAAGAGG - Intergenic
950629018 3:14268910-14268932 GATTAGTGCCCTTATACAAGAGG + Intergenic
950726376 3:14919830-14919852 GATTAGTGCCCTTATACAAGAGG - Intronic
950766232 3:15275093-15275115 GATCAGTGCCCTTGTAAGAAGGG + Intronic
950924137 3:16723301-16723323 GATTAGTGACCTTGTAAGAAGGG + Intergenic
950948775 3:16977946-16977968 GATTAGTGCCCTTATAAAAGAGG - Intronic
951108216 3:18770327-18770349 GATCAGTGCCCTTAAAAAAGAGG - Intergenic
951247840 3:20361672-20361694 GATTAGTGTCCTTATAAAAGAGG - Intergenic
951371790 3:21858502-21858524 GATTAGTGTCCTTATAAAAGAGG + Intronic
951503316 3:23414759-23414781 GATTAGTGCCCTTATAAAAGAGG + Intronic
951835662 3:26980666-26980688 GATTAGTAACCTCATAAGAGAGG - Intergenic
952678750 3:36066383-36066405 GACCAGTGTCCTTATAGAAGGGG + Intergenic
953242331 3:41160620-41160642 GATCAGTGCCTTTATAAAAGAGG + Intergenic
953336163 3:42095891-42095913 GATTAGTGGCCTTATAAAAGAGG + Intronic
953367911 3:42362614-42362636 GATTAGTGCCCTTATAAAAGAGG - Intergenic
953395430 3:42565578-42565600 GATCAGTATCCTTATATGAAAGG + Intronic
953549582 3:43891067-43891089 GATTAGTGCCCTTATAAAAGAGG + Intergenic
954920914 3:54190122-54190144 AATCAGTGCCCTTATAAAAGAGG - Intronic
955241652 3:57183277-57183299 GATCAGTGCCCTTATACAAGAGG - Intergenic
955941214 3:64148694-64148716 GATTAGTGCCCTTATAACAGAGG + Intronic
956417979 3:69052941-69052963 GGTTAGTGCCCTTATAAGAGAGG + Intergenic
956721780 3:72124404-72124426 TTTCTGTGACCTTATATGAGAGG + Intergenic
957185439 3:76935741-76935763 GATCAGTGCCCTTATAAAAGAGG - Intronic
957217810 3:77344457-77344479 GATTAGTGTCCTTATAAAAGAGG + Intronic
957257122 3:77852202-77852224 TATCAGTTACCTTGTATGACAGG + Intergenic
957292949 3:78300883-78300905 GATTAGTGCCCTTATAAAAGAGG + Intergenic
957906740 3:86567391-86567413 GATTAGTGCCCTTATAAGAAGGG - Intergenic
958124287 3:89335323-89335345 GATTAGTGCCCTTATAAAAGAGG - Intronic
958421467 3:93936464-93936486 GATTAGTGTCCTTATAAGAAGGG + Intronic
958612116 3:96439065-96439087 GACCAGTGTCCTTATATAAAAGG - Intergenic
959019518 3:101173222-101173244 GATTAGTGCCCTTATAAAAGAGG - Intergenic
959110638 3:102118226-102118248 GATTAGTGCCCTTATAAAAGAGG - Intronic
960694849 3:120386102-120386124 GATTAGTGCCCTTATAAAAGAGG + Intergenic
960931253 3:122853224-122853246 GATGAGTGCCCTTATAAAAGAGG - Intronic
961925837 3:130479157-130479179 GATCAGTGTCCTTATAATAAAGG + Intronic
962006901 3:131358880-131358902 GATTAGTGACTTTATAAAAGAGG + Intergenic
962969157 3:140382825-140382847 GATCAGTGCCCTTATAAATGAGG - Intronic
963052456 3:141153641-141153663 GATTAGTGCCCTTATAAAAGAGG - Intergenic
964011222 3:151894321-151894343 GATTAGTGTCCTTATAAAAGAGG + Intergenic
964034272 3:152177138-152177160 GATAAGTGGCCTTATAAGAAGGG - Intergenic
964492398 3:157250738-157250760 GATTAGTGCCCTTATAAAAGAGG - Intergenic
964844409 3:161030223-161030245 GATTAGTGACCTTATGAAAGAGG + Intronic
965175762 3:165330242-165330264 GATCACTGCCCTTATAAAAGAGG - Intergenic
965523835 3:169696224-169696246 GATTAGTGCCCTTATAAAAGAGG - Intergenic
966254950 3:177907308-177907330 GAATAGTGACCTTATAAAAGAGG + Intergenic
969144802 4:5113186-5113208 GATTAGTGTCCTTATAAGAGAGG + Intronic
969282747 4:6182102-6182124 GATTAGTGACCTTATAAGAAGGG + Intronic
969630326 4:8332213-8332235 GATACGTGCCCTTATAAGAGAGG + Intergenic
969965150 4:10986431-10986453 GATTAGTGACCTCATAATAGAGG + Intergenic
970971381 4:21988137-21988159 GATTAGTGCCCTTATAAAAGAGG - Intergenic
971032867 4:22660024-22660046 GATTAGTGCCCTTATACAAGAGG - Intergenic
971303699 4:25462637-25462659 GATTAGTGTCCTTATAAGAGAGG - Intergenic
971409180 4:26352341-26352363 GATTAGTGTCCTTATAAAAGAGG - Intronic
971459633 4:26881152-26881174 GATTAGTGCCCTTATAAAAGAGG + Intronic
971997257 4:33980535-33980557 GATTAGTGGCCTTATAAGAAAGG + Intergenic
972181643 4:36474200-36474222 GATTAGTGACCTTATGAAAGAGG - Intergenic
974040813 4:56855889-56855911 GATCAATGCCCTTATAAAAGTGG - Intergenic
975274933 4:72485843-72485865 GATTAGTGCCCTTATAAAAGAGG + Intronic
975713482 4:77183559-77183581 GATCTGTGACCTTGGTTGAGAGG + Intronic
976397604 4:84572951-84572973 GATTAGTGTCCTTATAAGAAAGG + Intergenic
976954924 4:90883965-90883987 ACTCAGTTACCTTATATTAGAGG - Intronic
977118619 4:93067462-93067484 GATAAGTAACCTTATAATAGAGG - Intronic
977210863 4:94216147-94216169 GATTAGTGCCCTTATAAAAGAGG - Intronic
977228336 4:94421411-94421433 GATTAGAGACCTTATAAAAGAGG + Intergenic
977377737 4:96228609-96228631 GATTAGTGTCCTTTTAAGAGAGG - Intergenic
977582799 4:98743971-98743993 GATTAGTGCTCTTATAAGAGAGG - Intergenic
978232689 4:106419624-106419646 GATTAGTGCCCTTATAAGAAGGG + Intergenic
978781794 4:112563888-112563910 GATTAGTGGCCTTATAAGAGAGG - Intronic
978827863 4:113046498-113046520 GATAAGTGGCCTTATAAAAGGGG + Intronic
979400959 4:120248890-120248912 GATTAGTGCCCTTATATAACAGG + Intergenic
979862844 4:125715870-125715892 GATTAGTGTCCTTATAAAAGAGG + Intergenic
980145572 4:128979378-128979400 GATTAGTGCCCTCATAAGAGAGG + Intronic
980482112 4:133400460-133400482 GATTAGTGATCTTATAAAAGTGG - Intergenic
980972157 4:139576830-139576852 GATCAGTGCCCTTATAAAAGAGG - Intronic
981134957 4:141200281-141200303 GATTAGTGCCCTTATAAAAGAGG - Intronic
981422497 4:144567284-144567306 GATGAGTGCCCTTATAACAGAGG + Intergenic
981642754 4:146964089-146964111 GATTAGTGCCCTTATAAAAGAGG - Intergenic
981676794 4:147351874-147351896 GATGAGTGCCCTTATAAAAGAGG - Intergenic
981896184 4:149803021-149803043 GATCAGTTACCTTATAAAATTGG - Intergenic
982079773 4:151778139-151778161 GATTAGTGCCCTTATAAAAGGGG - Intergenic
982099601 4:151955056-151955078 GATTAGTGCCCTTATAAAAGAGG + Intergenic
983228315 4:165105917-165105939 GATCAGTGCCCTTATAAAAGAGG + Intronic
983266597 4:165514071-165514093 GATTAGTGACCTCATAAAAGAGG - Intergenic
983849690 4:172565120-172565142 GATTAGTGGCCTTATAAAAGAGG - Intronic
983860701 4:172702606-172702628 GATTAGTGACCTTATAAAACAGG + Intronic
984468895 4:180140103-180140125 GATTAGTGCCCTTATAAAAGAGG - Intergenic
985139881 4:186828981-186829003 GATTAGTGCCCTTATAAAAGAGG + Intergenic
985324621 4:188754214-188754236 GATGAGTGCCCTTATAAGAAGGG - Intergenic
985563386 5:603195-603217 GATCAGTGCCCTCATAGGAGAGG - Intergenic
986395408 5:7324378-7324400 TTTCAGTGACCTTCCATGAGTGG - Intergenic
986465982 5:8024994-8025016 GATTAGTGACCTTATAAAAGAGG - Intergenic
986666942 5:10112727-10112749 GATTGGTGTCCTTATATAAGAGG - Intergenic
987302031 5:16605822-16605844 GATTAGTGCCCTTATAAAAGGGG - Intronic
987333436 5:16876974-16876996 GATTAGTGCCCTTATAAAAGAGG + Intronic
987799650 5:22677470-22677492 GATTAGTGCCCTTATAAGTGAGG - Intronic
988104157 5:26721997-26722019 GATTAGTGCCCTTATAAAAGAGG - Intergenic
988194812 5:27991304-27991326 GATTAGTGTCCTTATAAAAGAGG + Intergenic
988704924 5:33716151-33716173 GATTAGTGCCCTTATAAAAGAGG + Intronic
988777916 5:34493787-34493809 GATTAGTGCCCTTATAAAAGAGG + Intergenic
989055447 5:37361926-37361948 GATTAGTGCCCTTATAAAAGAGG + Intronic
989162433 5:38404324-38404346 GATCAGTGCCCTTATTAAAGAGG + Intronic
989399636 5:40994836-40994858 GATTAGTGCCCTTATAATAGAGG + Intergenic
989728812 5:44623161-44623183 GATTAGTGCCCTTATAAAAGAGG + Intergenic
990160059 5:52927933-52927955 GATTAGTGTCCTCATACGAGAGG + Intronic
990558292 5:56958025-56958047 GATTAGTGTCCTTATAAGAAGGG + Intronic
990637518 5:57746076-57746098 GATTAATGCCCTTATAAGAGAGG + Intergenic
990746907 5:58967861-58967883 GATCAGCGCCCTTATAAAAGAGG - Intergenic
990829180 5:59937620-59937642 GATTAGTGGCCTTATAAGAAGGG - Intronic
991559453 5:67934038-67934060 GCTTAGTGTCCTTATATAAGAGG + Intergenic
991571691 5:68061241-68061263 GATTAGTGCCCTTATAAAAGAGG + Intergenic
991582921 5:68175118-68175140 GATTAGTGCCCTTATAAAAGAGG - Intergenic
991597423 5:68319984-68320006 GATTAGTGACCTTATAAAAGAGG - Intergenic
991930923 5:71751745-71751767 GATTAGTGCCCTTATACGAAGGG - Intergenic
992154640 5:73943014-73943036 GATTAGTGCCCTTATAAAAGCGG + Intergenic
993072485 5:83182738-83182760 GATCAGTGCTCTTATAAAAGAGG + Intronic
993210051 5:84937710-84937732 GATCAGTGCCCCTATAAAAGAGG - Intergenic
993281723 5:85933639-85933661 AATCAGTGTCCTTATAAAAGAGG + Intergenic
994875162 5:105413088-105413110 AATCAGTGCCCTTATAAAAGAGG - Intergenic
994999302 5:107106743-107106765 GATTAATGACCTTATAAAAGAGG + Intergenic
996049046 5:118910914-118910936 GATTAGTGCCCTTATAAAAGAGG - Intronic
996400021 5:123052341-123052363 GATCAATGACCTTATAAAAGAGG - Intergenic
996428286 5:123339458-123339480 GATTTGTGACCTTATAAAAGAGG - Intergenic
996690796 5:126337727-126337749 GATTAGTGCCCTTATAAAAGAGG + Intergenic
997107743 5:131040459-131040481 GATTAGTGCCCTTACCTGAGAGG + Intergenic
997302567 5:132816430-132816452 GCTCAGTGAGCTTGGATGAGTGG + Exonic
998068293 5:139176695-139176717 GATTAGTGCCCTTATAAAAGAGG - Intronic
998671463 5:144358823-144358845 GATTAGTGACTTTATAAAAGAGG - Intronic
999122220 5:149218322-149218344 GACCAGTGTCCTTATAAAAGAGG - Intronic
1000298278 5:159931815-159931837 GATCAGTGTACTTATAAAAGAGG - Intronic
1001630407 5:173170844-173170866 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1001730275 5:173948837-173948859 GATTAGTGCCCTTATAAAAGAGG - Intronic
1001800382 5:174538451-174538473 GAAGGGTGACCATATATGAGAGG - Intergenic
1002119391 5:176990254-176990276 GACTAGTGCCCTTATAAGAGAGG + Intronic
1002447517 5:179298366-179298388 GATTAGTGCCCTTATCAGAGAGG + Intronic
1002558414 5:180062367-180062389 GATTAGTGCCCTTATAAAAGAGG - Intronic
1003648350 6:7935027-7935049 GATTAGTGCCCTTATAATAGAGG - Intronic
1003675507 6:8201013-8201035 GATCAGTGCCCTTATAAAAGAGG + Intergenic
1003687620 6:8320213-8320235 GATCAGTGCCCTTATAAAAGAGG - Intergenic
1003756402 6:9125828-9125850 AATTAGTGACCTTATAACAGAGG + Intergenic
1004021533 6:11780181-11780203 GATTAGTGACCTTATAAAACAGG - Intronic
1004271573 6:14200766-14200788 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1004904119 6:20220328-20220350 GATTAGTGCCCTTATAAAAGCGG - Intergenic
1005047104 6:21653095-21653117 GATTAGTGTCCTTATAAGAAGGG - Intergenic
1007828450 6:44619512-44619534 GATCAATGTCCTTATAAAAGAGG - Intergenic
1008357298 6:50569770-50569792 GATCAGTGCCCTTATGAAAGAGG + Intergenic
1009623153 6:66101385-66101407 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1009902310 6:69822296-69822318 GATTAGTGCCCTTATACAAGAGG + Intergenic
1010010553 6:71043185-71043207 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1010726306 6:79337604-79337626 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1011369929 6:86625569-86625591 GATCAGTGCCCTTACAAAAGAGG - Intergenic
1012487720 6:99740664-99740686 GATCACTTACATTATATTAGTGG + Intergenic
1012754967 6:103217432-103217454 GAACAGTAAGATTATATGAGAGG + Intergenic
1013095688 6:106942952-106942974 AATTAGTGACCTTATAAGAAGGG + Intergenic
1013374991 6:109506009-109506031 GATTAGTGCCCTTATAGAAGAGG - Intronic
1014009021 6:116455687-116455709 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1014613684 6:123576586-123576608 AATTAGTGACCTTATAAAAGCGG - Intronic
1014710010 6:124795777-124795799 GATTAGTGACCTTCTAAAAGAGG - Intronic
1014847684 6:126298708-126298730 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1015634610 6:135263358-135263380 GATGAGTGCCCTTATAAAAGAGG - Intergenic
1015797241 6:137025280-137025302 GATTAGTGCCCTTATAAAAGAGG + Intronic
1015887745 6:137936293-137936315 GATCATTGACCATAAATGCGTGG + Intergenic
1016040970 6:139431657-139431679 GGTTAGTGCCCTTATAAGAGAGG + Intergenic
1016265406 6:142227433-142227455 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1016582205 6:145641311-145641333 GACTAGTGTCCTTATAAGAGGGG + Intronic
1016926622 6:149356597-149356619 GATTAGTGGCCTTATAAAAGAGG - Intronic
1017155051 6:151315385-151315407 GATTAGTGCCCTCATATAAGAGG - Intronic
1017179815 6:151540692-151540714 GATTAGTGCCCTTATAAGAAGGG - Intronic
1017187495 6:151616846-151616868 GATTAGTGCCCTTATAAAAGAGG - Intronic
1017287639 6:152695131-152695153 GATTAGTGTCCTTATAAAAGAGG + Intergenic
1017371475 6:153714268-153714290 GATTAGTGTCCTTATAAAAGAGG - Intergenic
1017807636 6:157959895-157959917 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1018072685 6:160179412-160179434 GATTAGTGCCCTTATAAAAGAGG - Intronic
1018230301 6:161669065-161669087 GATTAGTGCCCTTATAGAAGAGG + Intronic
1018692021 6:166354215-166354237 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1018759681 6:166881805-166881827 GATTAGTGCCCTTATAAAAGAGG - Intronic
1019178806 6:170174936-170174958 GACCAGTGTCCTTATAAAAGGGG - Intergenic
1021160282 7:17264166-17264188 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1021362963 7:19739453-19739475 GATTAGTGACCTTATAAAGGAGG + Intronic
1021525392 7:21580692-21580714 GATCAGTGCCCATATAAAAGAGG - Intronic
1021767308 7:23962919-23962941 GATTAGTGCCCTTATACAAGAGG + Intergenic
1022416837 7:30185771-30185793 GATTTGTGACCTTATAAAAGAGG - Intergenic
1022525709 7:31035685-31035707 GATTAGTTACCTTATAAAAGAGG - Intergenic
1022829483 7:34051147-34051169 GATTAGTGCCCTTATAAAAGAGG - Intronic
1023001141 7:35808697-35808719 GATTAATGACCTTATAAAAGAGG - Intronic
1023368831 7:39491691-39491713 GACTAGTGACCTTATAAAAGAGG + Intronic
1023508401 7:40923997-40924019 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1023555946 7:41423227-41423249 CATTAGTGACCTTATAAAAGAGG + Intergenic
1023661528 7:42475990-42476012 GATTAGTGACCTTATAAGAATGG + Intergenic
1024218575 7:47268988-47269010 GATTAGTGGCCTTATAAAAGAGG - Intergenic
1024320909 7:48068215-48068237 GATTAGTGCCCTTATAGAAGAGG + Intergenic
1026546006 7:71322733-71322755 GATCAGGGTCCTTATAGGAGAGG + Intronic
1027534922 7:79386822-79386844 GATCAGTGACCTTATATGAGAGG + Intronic
1027834810 7:83227364-83227386 GATTAGTGACCTTATAAAAGAGG + Intergenic
1027989478 7:85338787-85338809 GAACAGTGACCTTATTGGAATGG + Intergenic
1028245916 7:88477141-88477163 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1028286508 7:89009634-89009656 GATCAGTGCCCTTATAAAAGAGG + Intronic
1030569267 7:111201797-111201819 GATTAGTGCCCTTATAAAAGAGG + Intronic
1030569515 7:111205195-111205217 GATTAGTGACCTTATAAAAGAGG - Intronic
1030874806 7:114800587-114800609 GATTAGTGTCCTTATAAAAGTGG - Intergenic
1031283378 7:119833857-119833879 GATTAGTGACTTTATAAAAGAGG + Intergenic
1031408550 7:121414595-121414617 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1031461958 7:122062453-122062475 GATTAGTGTCCTTATAAAAGAGG + Intergenic
1031800885 7:126243744-126243766 AATCAATGACCATATATGTGTGG + Intergenic
1031877506 7:127158642-127158664 GATTAGTGCCCTTATAAAAGAGG - Intronic
1033391532 7:140933167-140933189 GATTAGTGACCTTATAAAAAGGG - Intergenic
1034036628 7:147830361-147830383 TATTAGTGACCTTATACAAGAGG - Intronic
1034363681 7:150525430-150525452 GATTAATGCCCTTATATAAGAGG - Intergenic
1034481881 7:151328038-151328060 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1035930286 8:3773067-3773089 GATTAGTGTCCTTATAGAAGAGG - Intronic
1035969628 8:4233501-4233523 GATTAGTGCCCTTATAAAAGAGG + Intronic
1036439211 8:8765514-8765536 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1036589750 8:10158112-10158134 GATTAGTGCCCTTATAAAAGAGG - Intronic
1037002027 8:13731703-13731725 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1037944917 8:22982943-22982965 GATTAGTGCCCTTATAAAAGAGG - Intronic
1038277901 8:26137068-26137090 GATTAGTGACCGTATAAAAGGGG + Intergenic
1038282764 8:26180931-26180953 GATTAGTGGCCTTATAAAAGAGG + Intergenic
1038316667 8:26490215-26490237 GATTAGTGTCCTTATAAAAGAGG - Intronic
1038417099 8:27404959-27404981 GATTAGTGTCCTTATAAAAGAGG + Intronic
1038532254 8:28327974-28327996 GATTAGTGCCCTTATAAAAGAGG - Intronic
1038888108 8:31688302-31688324 GATTAGTGCCCTTATATAAAAGG + Intronic
1040485334 8:47865844-47865866 GATCAGTGCCCTTATATAAGAGG + Intronic
1041325365 8:56657989-56658011 GTTCAGTGACTTGATATGGGTGG - Intergenic
1041756617 8:61320720-61320742 AATCAGTGCCCTTATAAAAGAGG - Intronic
1042168700 8:65971925-65971947 ATTCAGTGACCTTATAGAAGAGG + Intergenic
1042169008 8:65974273-65974295 GATCAGTGACTTTATAGAAGAGG + Intergenic
1042429673 8:68690589-68690611 GTTCAGTGACCTTATAGAAGAGG - Intronic
1042691865 8:71508595-71508617 GATTAGTGGCCTTATAAAAGGGG + Intronic
1042938753 8:74086765-74086787 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1043614947 8:82114038-82114060 GATTAGTGCCTTTATATAAGAGG - Intergenic
1043940215 8:86188581-86188603 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1044415565 8:91935379-91935401 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1044538539 8:93384592-93384614 GATTAGTGCCCTTATAGAAGAGG - Intergenic
1045142024 8:99296721-99296743 AATTAGTGACCTTATAAAAGAGG + Intronic
1045395276 8:101754551-101754573 GATTAGTGCCCTTATAAAAGAGG - Intronic
1046792992 8:118341672-118341694 GATCAGTGCCCTTATAAAAGCGG - Intronic
1046902351 8:119536845-119536867 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1047145358 8:122192701-122192723 GATCAGTGGCCTTATAAATGTGG - Intergenic
1047940731 8:129825514-129825536 GATCAGTGCCCTTATAGGAAGGG - Intergenic
1048218499 8:132518973-132518995 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1048684900 8:136893619-136893641 GATTAGTGACTTTATAAAAGAGG + Intergenic
1049156218 8:141068327-141068349 GATTAGTGACCTTATATGAGAGG - Intergenic
1049266279 8:141669523-141669545 GATCAGTGACCTTATAAAAGGGG + Intergenic
1050005795 9:1128946-1128968 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1050971618 9:11883832-11883854 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1051114927 9:13683754-13683776 GATTAGTGTCCTTATAAAAGAGG - Intergenic
1051500991 9:17777718-17777740 GATTGGTAACCTTATAAGAGAGG - Intronic
1052100305 9:24438022-24438044 GGTCAGTGTCCTTATAGAAGAGG - Intergenic
1052143305 9:25016377-25016399 GATTAGTGGCCTTATAAAAGAGG + Intergenic
1052431415 9:28371483-28371505 GATTAGTGCCCTTATAAAAGAGG - Intronic
1052666655 9:31503409-31503431 GATTAATGGCCTTATAAGAGAGG + Intergenic
1055088807 9:72341698-72341720 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1055702961 9:78966217-78966239 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1055716723 9:79126211-79126233 GATCAATGTCCTTATAAAAGAGG + Intergenic
1055836932 9:80454899-80454921 GATTAGTGACCCTATAAAAGAGG - Intergenic
1056218266 9:84426046-84426068 GATCTGTGTCTTTATCTGAGTGG - Intergenic
1056423486 9:86453250-86453272 GATCAGTGCCCTTATAAAAGAGG - Intergenic
1056495346 9:87149804-87149826 GATCAGTGCCCTTATAAAAAAGG + Intronic
1056730704 9:89163947-89163969 GATTAGTGCCCTTATAAAAGAGG - Intronic
1056782156 9:89558806-89558828 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1056842834 9:90012601-90012623 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1056905584 9:90644917-90644939 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1056921069 9:90789622-90789644 GGTCAGTAGCCTTCTATGAGTGG - Intergenic
1058140998 9:101356835-101356857 GATCAGTGCCCTTATGAAAGAGG - Intergenic
1058335857 9:103828200-103828222 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1058849980 9:109002263-109002285 GATCAGTGTTCTTATAAAAGAGG - Intronic
1059465155 9:114464494-114464516 GATTAGTGCCCTTATAAAAGAGG - Intronic
1059785406 9:117577353-117577375 GATTAGTGGCCTTTTATTAGAGG + Intergenic
1059873783 9:118608673-118608695 AATAAGCGTCCTTATATGAGTGG + Intergenic
1185758071 X:2667977-2667999 GATGAGTGCCCTTATAAAAGGGG + Intergenic
1185997858 X:4973075-4973097 GATGAGTGCCCTTATAAAAGCGG + Intergenic
1186096819 X:6111286-6111308 GATGAGTGTCCTTATAAAAGAGG + Intronic
1186258660 X:7751366-7751388 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1186451789 X:9680104-9680126 GATCAGTGTCCCTATAAAAGAGG - Intronic
1186462201 X:9757286-9757308 GATCAGTGCCCTTGTAAAAGGGG - Intronic
1186688286 X:11948330-11948352 GATTAGTGCCCTTATATGAGGGG + Intergenic
1186836207 X:13441052-13441074 GATTAGTGCCCTTATAAGAGAGG - Intergenic
1187112530 X:16316270-16316292 AATCAGTGATGTTATTTGAGGGG + Intergenic
1187554590 X:20339810-20339832 GATTAGTGCCCTTATAAGAAGGG + Intergenic
1187609370 X:20924552-20924574 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1188584568 X:31757644-31757666 GATCAGTGCCCTTATAAAAGCGG - Intronic
1188635137 X:32420575-32420597 TATCACTGACCTTATTTAAGAGG - Intronic
1188691647 X:33136613-33136635 GATTAGTGCCCTTATAAAAGAGG + Intronic
1188703768 X:33300629-33300651 GATTAATGCCCTTATAAGAGAGG + Intronic
1189170218 X:38901777-38901799 GATTAGTGACCTTATAAAAGAGG + Intergenic
1189256854 X:39646599-39646621 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1189351151 X:40276783-40276805 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1189656942 X:43254471-43254493 GATTAGTGCCCTTATAAGAAGGG + Intergenic
1189740154 X:44109489-44109511 GATTAGTGACCTTATAAATGAGG - Intergenic
1190163967 X:48056207-48056229 GATTAGTGACCTAATAATAGAGG - Intronic
1190251240 X:48727690-48727712 GATCAGAGACCTAATATGCAGGG + Intergenic
1190417386 X:50193401-50193423 GGTCAGTGCCCTTATAGGTGAGG - Exonic
1190421621 X:50290402-50290424 GATTAGTGCCCTTATAAAAGAGG - Intronic
1190537166 X:51440805-51440827 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1191720005 X:64221557-64221579 GATTAGTGACCTTATAAAAGAGG - Intergenic
1192200616 X:69064343-69064365 GATTAGTGCCCTTTTAAGAGAGG - Intergenic
1192272166 X:69591289-69591311 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1192867625 X:75152311-75152333 GATTAGTTCCCTTATAAGAGGGG + Intronic
1193181612 X:78464994-78465016 GATTAGTGTCCTTATAAAAGAGG - Intergenic
1193299939 X:79878104-79878126 GATTAGTAACCTTATAACAGAGG + Intergenic
1193458641 X:81762190-81762212 GATTAGTGTCCTTATAAAAGAGG - Intergenic
1193985178 X:88232406-88232428 GATCATTGACTGTATATGTGTGG - Intergenic
1194353598 X:92854146-92854168 GATTAGTAACCTTATAAAAGAGG - Intergenic
1194796919 X:98223299-98223321 GATCAGTGTCCTTATAAAAGAGG + Intergenic
1194833181 X:98650460-98650482 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1194957586 X:100198710-100198732 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1195116816 X:101707473-101707495 GATGAGTGCCCTTAGAAGAGAGG - Intergenic
1195332870 X:103820008-103820030 GATTAGTGTCCTTATAAAAGAGG + Intergenic
1195430314 X:104781942-104781964 GATTAGTGCCCTTATAAAAGAGG + Intronic
1195454761 X:105055256-105055278 GATTAGTGTCCTTATAAAAGAGG - Intronic
1196081964 X:111642105-111642127 GATTAGTGTCCTTATAAGATAGG - Intergenic
1196404063 X:115346187-115346209 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1196931297 X:120684432-120684454 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1197063804 X:122214891-122214913 TATTAGTGACCTTATAAAAGAGG - Intergenic
1197192928 X:123668919-123668941 AAACAGTCACCTTGTATGAGTGG + Intronic
1197332527 X:125171566-125171588 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1197404525 X:126033767-126033789 GATCAGTGCCCTTATATAAGAGG - Intergenic
1197596031 X:128465117-128465139 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1198098492 X:133403421-133403443 GATTAGTGCCCTTATAAAAGAGG - Intronic
1198405777 X:136311119-136311141 GATTAGTGCCCTTATAGAAGAGG - Intronic
1198546434 X:137697406-137697428 GATTAGTGGCCTTATAAAAGAGG + Intergenic
1198671772 X:139088871-139088893 GATTAGTGTCCTTATAAAAGAGG + Intronic
1199226221 X:145377900-145377922 GTTCAGTGCCCTTATAGAAGAGG + Intergenic
1199287479 X:146069800-146069822 GATTAGTGCCCTTATAAAAGAGG + Intergenic
1199551247 X:149063974-149063996 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1199658672 X:150024197-150024219 GATTAGTGGCCTTATAAAAGAGG - Intergenic
1200180868 X:154150005-154150027 GATTAGTGCCCTTATAAAAGAGG - Intronic
1200186511 X:154187119-154187141 GATTAGTGCCCTTATAAAAGAGG - Intergenic
1200192163 X:154224257-154224279 GATTAGTGCCCTTATAAAAGAGG - Intronic
1200197918 X:154262061-154262083 GATTAGTGCCCTTATAAAAGAGG - Intronic
1200761053 Y:7039458-7039480 GATCAGTGCCCATATAAAAGAGG - Intronic
1201906408 Y:19090220-19090242 GATGAGTGCCCTTATAAAAGTGG + Intergenic