ID: 1027542966

View in Genome Browser
Species Human (GRCh38)
Location 7:79491731-79491753
Sequence CAGTGTGAAGACAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027542966_1027542979 29 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542979 7:79491783-79491805 GAGCTGCTCTCACTGTCTCAGGG No data
1027542966_1027542978 28 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542978 7:79491782-79491804 GGAGCTGCTCTCACTGTCTCAGG No data
1027542966_1027542972 -8 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542972 7:79491746-79491768 TCACACTGAGTAGGCTGAGGGGG 0: 25
1: 183
2: 337
3: 547
4: 943
1027542966_1027542975 5 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542975 7:79491759-79491781 GCTGAGGGGGAAGAGGATGAGGG No data
1027542966_1027542980 30 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542980 7:79491784-79491806 AGCTGCTCTCACTGTCTCAGGGG No data
1027542966_1027542973 -2 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542973 7:79491752-79491774 TGAGTAGGCTGAGGGGGAAGAGG 0: 3
1: 60
2: 259
3: 514
4: 1148
1027542966_1027542977 7 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542977 7:79491761-79491783 TGAGGGGGAAGAGGATGAGGGGG No data
1027542966_1027542974 4 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542974 7:79491758-79491780 GGCTGAGGGGGAAGAGGATGAGG No data
1027542966_1027542971 -9 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542971 7:79491745-79491767 TTCACACTGAGTAGGCTGAGGGG No data
1027542966_1027542976 6 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542976 7:79491760-79491782 CTGAGGGGGAAGAGGATGAGGGG No data
1027542966_1027542970 -10 Left 1027542966 7:79491731-79491753 CCATCTTCCTTGTCTTCACACTG No data
Right 1027542970 7:79491744-79491766 CTTCACACTGAGTAGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027542966 Original CRISPR CAGTGTGAAGACAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr