ID: 1027545071

View in Genome Browser
Species Human (GRCh38)
Location 7:79517365-79517387
Sequence CCTTATATCAAGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027545071_1027545075 26 Left 1027545071 7:79517365-79517387 CCCTTCACCTTCTTGATATAAGG No data
Right 1027545075 7:79517414-79517436 TTTCCCTGAGTTCAATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027545071 Original CRISPR CCTTATATCAAGAAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr