ID: 1027545075

View in Genome Browser
Species Human (GRCh38)
Location 7:79517414-79517436
Sequence TTTCCCTGAGTTCAATTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027545071_1027545075 26 Left 1027545071 7:79517365-79517387 CCCTTCACCTTCTTGATATAAGG No data
Right 1027545075 7:79517414-79517436 TTTCCCTGAGTTCAATTGAAAGG No data
1027545074_1027545075 19 Left 1027545074 7:79517372-79517394 CCTTCTTGATATAAGGAAAACTT No data
Right 1027545075 7:79517414-79517436 TTTCCCTGAGTTCAATTGAAAGG No data
1027545073_1027545075 25 Left 1027545073 7:79517366-79517388 CCTTCACCTTCTTGATATAAGGA No data
Right 1027545075 7:79517414-79517436 TTTCCCTGAGTTCAATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027545075 Original CRISPR TTTCCCTGAGTTCAATTGAA AGG Intergenic
No off target data available for this crispr