ID: 1027554525

View in Genome Browser
Species Human (GRCh38)
Location 7:79647436-79647458
Sequence CTTAAAATTCAGAATCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027554525_1027554531 21 Left 1027554525 7:79647436-79647458 CCATCCAGATTCTGAATTTTAAG No data
Right 1027554531 7:79647480-79647502 CCTGGCTAAGAAGCATTCCTGGG No data
1027554525_1027554532 22 Left 1027554525 7:79647436-79647458 CCATCCAGATTCTGAATTTTAAG No data
Right 1027554532 7:79647481-79647503 CTGGCTAAGAAGCATTCCTGGGG No data
1027554525_1027554529 20 Left 1027554525 7:79647436-79647458 CCATCCAGATTCTGAATTTTAAG No data
Right 1027554529 7:79647479-79647501 ACCTGGCTAAGAAGCATTCCTGG No data
1027554525_1027554527 3 Left 1027554525 7:79647436-79647458 CCATCCAGATTCTGAATTTTAAG No data
Right 1027554527 7:79647462-79647484 GTAATTTCAGCCATTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027554525 Original CRISPR CTTAAAATTCAGAATCTGGA TGG (reversed) Intergenic
No off target data available for this crispr