ID: 1027554892

View in Genome Browser
Species Human (GRCh38)
Location 7:79651458-79651480
Sequence CTGCTCACTGAAGCATAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027554892_1027554895 12 Left 1027554892 7:79651458-79651480 CCCACTTATGCTTCAGTGAGCAG No data
Right 1027554895 7:79651493-79651515 AACTGTTATTATACCTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027554892 Original CRISPR CTGCTCACTGAAGCATAAGT GGG (reversed) Intergenic
No off target data available for this crispr