ID: 1027554895

View in Genome Browser
Species Human (GRCh38)
Location 7:79651493-79651515
Sequence AACTGTTATTATACCTTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027554892_1027554895 12 Left 1027554892 7:79651458-79651480 CCCACTTATGCTTCAGTGAGCAG No data
Right 1027554895 7:79651493-79651515 AACTGTTATTATACCTTATATGG No data
1027554891_1027554895 29 Left 1027554891 7:79651441-79651463 CCAGGAGCAATTACTGACCCACT No data
Right 1027554895 7:79651493-79651515 AACTGTTATTATACCTTATATGG No data
1027554893_1027554895 11 Left 1027554893 7:79651459-79651481 CCACTTATGCTTCAGTGAGCAGA No data
Right 1027554895 7:79651493-79651515 AACTGTTATTATACCTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027554895 Original CRISPR AACTGTTATTATACCTTATA TGG Intergenic
No off target data available for this crispr