ID: 1027556039

View in Genome Browser
Species Human (GRCh38)
Location 7:79665883-79665905
Sequence AGCAAAAAACCCAAAGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027556039_1027556043 -5 Left 1027556039 7:79665883-79665905 CCAACCCCTTTGGGTTTTTTGCT No data
Right 1027556043 7:79665901-79665923 TTGCTGCTATCGCTCTGTTTTGG No data
1027556039_1027556044 7 Left 1027556039 7:79665883-79665905 CCAACCCCTTTGGGTTTTTTGCT No data
Right 1027556044 7:79665913-79665935 CTCTGTTTTGGCTTTTCCTTTGG No data
1027556039_1027556045 10 Left 1027556039 7:79665883-79665905 CCAACCCCTTTGGGTTTTTTGCT No data
Right 1027556045 7:79665916-79665938 TGTTTTGGCTTTTCCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027556039 Original CRISPR AGCAAAAAACCCAAAGGGGT TGG (reversed) Intergenic
No off target data available for this crispr