ID: 1027566337

View in Genome Browser
Species Human (GRCh38)
Location 7:79799645-79799667
Sequence GTAGATACCTATTGTAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027566337_1027566341 21 Left 1027566337 7:79799645-79799667 CCACTCCTACAATAGGTATCTAC No data
Right 1027566341 7:79799689-79799711 GGAGACAGCTACACCTCCACAGG No data
1027566337_1027566339 0 Left 1027566337 7:79799645-79799667 CCACTCCTACAATAGGTATCTAC No data
Right 1027566339 7:79799668-79799690 AGCTTCCTTTAAAATCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027566337 Original CRISPR GTAGATACCTATTGTAGGAG TGG (reversed) Intergenic
No off target data available for this crispr