ID: 1027571774

View in Genome Browser
Species Human (GRCh38)
Location 7:79877100-79877122
Sequence GCAGTTAAAGTGATCGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027571774_1027571775 -6 Left 1027571774 7:79877100-79877122 CCATGAACGATCACTTTAACTGC No data
Right 1027571775 7:79877117-79877139 AACTGCATTGTGCAATTTACTGG No data
1027571774_1027571776 1 Left 1027571774 7:79877100-79877122 CCATGAACGATCACTTTAACTGC No data
Right 1027571776 7:79877124-79877146 TTGTGCAATTTACTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027571774 Original CRISPR GCAGTTAAAGTGATCGTTCA TGG (reversed) Intergenic
No off target data available for this crispr