ID: 1027571775

View in Genome Browser
Species Human (GRCh38)
Location 7:79877117-79877139
Sequence AACTGCATTGTGCAATTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027571773_1027571775 21 Left 1027571773 7:79877073-79877095 CCAAATGTTGTGAAGAATATACA No data
Right 1027571775 7:79877117-79877139 AACTGCATTGTGCAATTTACTGG No data
1027571774_1027571775 -6 Left 1027571774 7:79877100-79877122 CCATGAACGATCACTTTAACTGC No data
Right 1027571775 7:79877117-79877139 AACTGCATTGTGCAATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027571775 Original CRISPR AACTGCATTGTGCAATTTAC TGG Intergenic
No off target data available for this crispr