ID: 1027573086

View in Genome Browser
Species Human (GRCh38)
Location 7:79896335-79896357
Sequence CTTATTCAGCACCTCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027573086_1027573094 22 Left 1027573086 7:79896335-79896357 CCCAGCTAGAGGTGCTGAATAAG No data
Right 1027573094 7:79896380-79896402 CCTCTCCATGTGGCTAGGCTGGG No data
1027573086_1027573092 21 Left 1027573086 7:79896335-79896357 CCCAGCTAGAGGTGCTGAATAAG No data
Right 1027573092 7:79896379-79896401 ACCTCTCCATGTGGCTAGGCTGG No data
1027573086_1027573090 12 Left 1027573086 7:79896335-79896357 CCCAGCTAGAGGTGCTGAATAAG No data
Right 1027573090 7:79896370-79896392 TTTCATGAGACCTCTCCATGTGG No data
1027573086_1027573091 17 Left 1027573086 7:79896335-79896357 CCCAGCTAGAGGTGCTGAATAAG No data
Right 1027573091 7:79896375-79896397 TGAGACCTCTCCATGTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027573086 Original CRISPR CTTATTCAGCACCTCTAGCT GGG (reversed) Intergenic
No off target data available for this crispr