ID: 1027573090

View in Genome Browser
Species Human (GRCh38)
Location 7:79896370-79896392
Sequence TTTCATGAGACCTCTCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027573087_1027573090 11 Left 1027573087 7:79896336-79896358 CCAGCTAGAGGTGCTGAATAAGC No data
Right 1027573090 7:79896370-79896392 TTTCATGAGACCTCTCCATGTGG No data
1027573086_1027573090 12 Left 1027573086 7:79896335-79896357 CCCAGCTAGAGGTGCTGAATAAG No data
Right 1027573090 7:79896370-79896392 TTTCATGAGACCTCTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027573090 Original CRISPR TTTCATGAGACCTCTCCATG TGG Intergenic
No off target data available for this crispr