ID: 1027573091

View in Genome Browser
Species Human (GRCh38)
Location 7:79896375-79896397
Sequence TGAGACCTCTCCATGTGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027573087_1027573091 16 Left 1027573087 7:79896336-79896358 CCAGCTAGAGGTGCTGAATAAGC No data
Right 1027573091 7:79896375-79896397 TGAGACCTCTCCATGTGGCTAGG No data
1027573089_1027573091 -7 Left 1027573089 7:79896359-79896381 CCTCAGTTCTCTTTCATGAGACC No data
Right 1027573091 7:79896375-79896397 TGAGACCTCTCCATGTGGCTAGG No data
1027573088_1027573091 -6 Left 1027573088 7:79896358-79896380 CCCTCAGTTCTCTTTCATGAGAC No data
Right 1027573091 7:79896375-79896397 TGAGACCTCTCCATGTGGCTAGG No data
1027573086_1027573091 17 Left 1027573086 7:79896335-79896357 CCCAGCTAGAGGTGCTGAATAAG No data
Right 1027573091 7:79896375-79896397 TGAGACCTCTCCATGTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027573091 Original CRISPR TGAGACCTCTCCATGTGGCT AGG Intergenic
No off target data available for this crispr