ID: 1027575923

View in Genome Browser
Species Human (GRCh38)
Location 7:79930947-79930969
Sequence AAAGCCTCATGGAATGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027575921_1027575923 1 Left 1027575921 7:79930923-79930945 CCAGGTTTTGGTATAAGGATGAT No data
Right 1027575923 7:79930947-79930969 AAAGCCTCATGGAATGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027575923 Original CRISPR AAAGCCTCATGGAATGAGTT AGG Intergenic
No off target data available for this crispr