ID: 1027580209

View in Genome Browser
Species Human (GRCh38)
Location 7:79983618-79983640
Sequence CTGTTCCAAAGTCAGATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027580209_1027580212 16 Left 1027580209 7:79983618-79983640 CCCAATATCTGACTTTGGAACAG No data
Right 1027580212 7:79983657-79983679 AACAAAACTCAATTAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027580209 Original CRISPR CTGTTCCAAAGTCAGATATT GGG (reversed) Intergenic
No off target data available for this crispr