ID: 1027583960

View in Genome Browser
Species Human (GRCh38)
Location 7:80033785-80033807
Sequence TAGTCATATTTTTCACTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027583958_1027583960 -5 Left 1027583958 7:80033767-80033789 CCAAAGTGAGAAAGCTAATAGTC No data
Right 1027583960 7:80033785-80033807 TAGTCATATTTTTCACTGGTTGG No data
1027583957_1027583960 30 Left 1027583957 7:80033732-80033754 CCTATCAAAAAACAGCAATAATA No data
Right 1027583960 7:80033785-80033807 TAGTCATATTTTTCACTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027583960 Original CRISPR TAGTCATATTTTTCACTGGT TGG Intergenic
No off target data available for this crispr