ID: 1027584724

View in Genome Browser
Species Human (GRCh38)
Location 7:80044258-80044280
Sequence GGGTAAATACAGATACAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027584720_1027584724 2 Left 1027584720 7:80044233-80044255 CCTATACAAGGAGGATACAGGCA No data
Right 1027584724 7:80044258-80044280 GGGTAAATACAGATACAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027584724 Original CRISPR GGGTAAATACAGATACAAGG AGG Intergenic
No off target data available for this crispr