ID: 1027593401

View in Genome Browser
Species Human (GRCh38)
Location 7:80141904-80141926
Sequence TGTTATCAAAAACTAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027593401 Original CRISPR TGTTATCAAAAACTAGAGGA AGG (reversed) Intronic
900771211 1:4546141-4546163 TGTTACCAAATATTAAAGGAAGG + Intergenic
901337082 1:8459388-8459410 TGTCATTTAAAACTGGAGGAAGG + Intronic
903028664 1:20447320-20447342 TGTTATCCCAAACTATAGAAGGG + Intergenic
907280796 1:53346015-53346037 TGTGCTCAAAAACTAAAGCAGGG + Intergenic
908581143 1:65518771-65518793 TGTTATTGGAAACTGGAGGAAGG - Intronic
909254658 1:73404531-73404553 TGTTTTCAAAACCAAGAGAATGG - Intergenic
909327930 1:74375751-74375773 TCTTCTCAAAAACTTGAGGATGG - Intronic
909586887 1:77300252-77300274 TGTTAGCAAATTCTATAGGATGG + Intronic
911105763 1:94130158-94130180 TGTTATCAAAAATGAGAGGCAGG + Intergenic
911588037 1:99713894-99713916 TTTGAGCAAAAACTTGAGGAAGG + Intronic
911893956 1:103405718-103405740 TGGGATCAAATACTAGAGGAAGG + Intergenic
913176028 1:116273939-116273961 TGTTATCCAAAAAAAGAGAAAGG + Intergenic
917577845 1:176343004-176343026 TGAGATCAAAAACAAGAAGAGGG - Intergenic
918129475 1:181612766-181612788 TGTACTCAAAAACTGAAGGAGGG - Intronic
918822758 1:189277952-189277974 TGTAATCAGAAATAAGAGGATGG + Intergenic
919503742 1:198371541-198371563 TGTAATAAAAAAAAAGAGGAAGG + Intergenic
919596774 1:199573844-199573866 TCTCAACAAAAACTAGAGAAAGG + Intergenic
921209391 1:212879947-212879969 TGTTATCTGAACCTAGAGTATGG - Intronic
923719434 1:236454515-236454537 TGTCATCCAGAACTAGAGCAGGG + Intronic
1062800731 10:377785-377807 TACTTTCAAAAACTAGAAGATGG + Intronic
1062887324 10:1027420-1027442 TGTTATCAAAATTTCAAGGAAGG + Intergenic
1063993532 10:11593883-11593905 TGTTATCAAACGCTAGAACATGG - Intronic
1064515537 10:16143916-16143938 TGTTATTAAAAAAGTGAGGAAGG - Intergenic
1067330792 10:45316721-45316743 TGTTAAAAAAAACTTGTGGATGG + Intergenic
1068735529 10:60409748-60409770 TGGGATCAGAAGCTAGAGGAGGG - Intronic
1068980806 10:63060618-63060640 TGTAATTAAAAACTAGGGCACGG + Intergenic
1069333002 10:67315763-67315785 AGATATCAAAAATCAGAGGAGGG + Intronic
1070590634 10:77798281-77798303 TGTTGTTTAAAACTGGAGGAGGG + Intronic
1071271036 10:84007716-84007738 TTGTATCAAATACTAGAAGATGG - Intergenic
1071750966 10:88475291-88475313 TGTTATCAAACTCAAGAGAAAGG + Intronic
1072504294 10:96048602-96048624 GGTTATCAGAAGCTAGAGGGTGG - Intronic
1072800096 10:98386838-98386860 ATTTATCAAAAACTAGAGATTGG - Intronic
1073166588 10:101459459-101459481 TGTTACAAAAAAATAGAGGTAGG - Intronic
1073856097 10:107674875-107674897 GGTTGTCAGAAACTAGGGGAAGG - Intergenic
1076210950 10:128644504-128644526 AGTTAACAAAAAACAGAGGAAGG - Intergenic
1076773899 10:132682506-132682528 AGTTGGCAAAAACTAGAGGCTGG + Intronic
1079791156 11:24741321-24741343 TGTTATTAAAAACTACTAGATGG + Intronic
1080316164 11:30951418-30951440 TGCTATCAATAACTAAAAGAAGG + Intronic
1080940648 11:36914046-36914068 TGATATGAAAAAATAAAGGAAGG + Intergenic
1082890078 11:58129774-58129796 TGTTATAAAGAAATAGAGAAGGG - Intronic
1085823335 11:79816814-79816836 TGTTAGCAAGGACTAGATGATGG + Intergenic
1089796477 11:120985360-120985382 TGATAACCAAAACAAGAGGAGGG - Intronic
1090372273 11:126264798-126264820 TGTTATCCAAAAGCAGAGCATGG + Intronic
1090716824 11:129438495-129438517 TCCTATCAAAAAGTAAAGGAAGG + Intronic
1091995611 12:4991033-4991055 TGTTTTCCAAAATTAGGGGAGGG - Intergenic
1092822727 12:12368234-12368256 AGGTATCATAAACTAAAGGAAGG - Intronic
1092860090 12:12712833-12712855 TGTGCACAAAAACTAGAGGTTGG - Intergenic
1092982015 12:13805399-13805421 AGTTATCCAAAACTACAAGATGG + Intronic
1093480654 12:19600989-19601011 TGTTATTGAAAACTGGAAGAAGG + Intronic
1093949084 12:25143518-25143540 TGGTATCAAAAATTATAGGCCGG - Intronic
1094698434 12:32844694-32844716 TCTTATCAGAAAGTAGATGAGGG + Intronic
1095617410 12:44207491-44207513 TGCTATTAAAAATCAGAGGAAGG - Intronic
1095653213 12:44638171-44638193 AGTTAAGAAAGACTAGAGGAAGG - Intronic
1096546938 12:52346542-52346564 TGTTATCCAAGACTAGGGGTTGG + Intergenic
1096766110 12:53891265-53891287 TCATATCCAAAACTAGAGCAAGG - Intergenic
1097367400 12:58732254-58732276 TGTTTTCGGAAATTAGAGGAGGG + Intronic
1097603199 12:61720496-61720518 TGTTATTAAAAAGTAGAGAGAGG - Intronic
1098538984 12:71630190-71630212 TGTTTTCAAAAAATAGAGGAAGG - Intronic
1098580369 12:72092417-72092439 TGTTTTCAAACACAAGTGGATGG + Intronic
1098998731 12:77151296-77151318 TGTTATGAAAAACTGAATGAAGG - Intergenic
1100637965 12:96453812-96453834 TGTTATTAGAAACTTGAAGATGG - Intergenic
1100942110 12:99734868-99734890 TGTCATTTAAAACTAGAGAAAGG - Intronic
1102912819 12:116731446-116731468 TATTATAAAAAACTAAAGGCTGG + Intronic
1103990556 12:124796441-124796463 TGTCATCAAAAACAACAGGAAGG + Intronic
1105455367 13:20535931-20535953 TGCTCTCAAAAACAAGAGCAAGG + Intergenic
1108110836 13:47070522-47070544 TGTTATGAAGTACTAGGGGATGG + Intergenic
1109765934 13:66897385-66897407 TGTGAGCAAAAAACAGAGGAAGG + Intronic
1109822351 13:67674409-67674431 TGCTATCAAAAATTGGAGGATGG + Intergenic
1110027686 13:70562363-70562385 TGCTATCAATAACTGGAGAAAGG - Intergenic
1110281017 13:73694620-73694642 TGTAATCAAATACTAGGGGCAGG + Exonic
1110646571 13:77892608-77892630 TGTCATGAAAGTCTAGAGGAAGG - Intergenic
1111707994 13:91775368-91775390 TGTTATAAAAACCCAGAGGGGGG - Intronic
1111751113 13:92333368-92333390 TTTTATCAGAACCTAGGGGAAGG + Intronic
1111878961 13:93931251-93931273 GGTGATCAGAAACCAGAGGAAGG + Intronic
1112687535 13:101848449-101848471 TAGTATCAAAAACAAGAGAAAGG + Intronic
1113163107 13:107405766-107405788 TGTTAAAAAAAACTACAGAATGG + Intronic
1113472534 13:110557163-110557185 TGTTATCAGAAGCTGGAGGAGGG + Intronic
1114792824 14:25679120-25679142 TGTTTTCAAACACCAGAAGAAGG - Intergenic
1115912374 14:38270651-38270673 TGATATCCAAAACCACAGGATGG - Intergenic
1117475864 14:56094517-56094539 TGCTATTGAAAATTAGAGGACGG + Intergenic
1118168229 14:63358892-63358914 TGTTATTAGAAACCAGAGGAAGG + Intergenic
1118455279 14:65940353-65940375 ATTTATTAAAAACTAGGGGAGGG + Intergenic
1119532170 14:75370020-75370042 TGTTCTGAAAAACTTGAAGAGGG - Intergenic
1119949427 14:78729240-78729262 TGTTAGCAAATACTAAAGGTAGG + Intronic
1123147279 14:106144506-106144528 AGTGATCAAAAACAAAAGGATGG + Intergenic
1123804038 15:23853072-23853094 TGGCATGAAAAACCAGAGGATGG + Intergenic
1128029125 15:64463724-64463746 TGTTATCAAAAAATATATAAAGG - Intronic
1128365946 15:67002994-67003016 TGTTATTGGAAACTGGAGGAAGG + Intergenic
1128936501 15:71750467-71750489 TGTTATCCAGAAAGAGAGGAAGG + Intronic
1130043449 15:80425742-80425764 TGTTTTGAAAATCTATAGGAAGG + Intronic
1130420954 15:83746404-83746426 TGTTAGCAAAAAAGAAAGGAGGG + Intronic
1133406042 16:5525325-5525347 TGTTGTATAAAACAAGAGGAAGG - Intergenic
1134439812 16:14292601-14292623 TGTGTTAAGAAACTAGAGGAAGG - Intergenic
1136691652 16:32036554-32036576 AGTGATCAAAAACAAAAGGATGG - Intergenic
1136792241 16:32980117-32980139 AGTGATCAAAAACAAAAGGATGG - Intergenic
1136877576 16:33873791-33873813 AGTGATCAAAAACAAAAGGATGG + Intergenic
1138592455 16:58009421-58009443 TGTTAAGAAAAACTGGAGGCTGG + Intronic
1140864598 16:79049248-79049270 TATTTACAAAAACAAGAGGAGGG + Intronic
1203094447 16_KI270728v1_random:1241581-1241603 AGTGATCAAAAACAAAAGGATGG - Intergenic
1144247266 17:13379392-13379414 TGGTATCAAAATCTAGACAAGGG + Intergenic
1144267451 17:13585026-13585048 TGGTATCAAATACTACAGAAAGG - Intronic
1144392562 17:14808821-14808843 TGTTATCAAATTCTTAAGGAAGG + Intergenic
1144777507 17:17792149-17792171 TGATATCAAAAACAGGAGGCAGG + Intronic
1144917014 17:18732154-18732176 TGATATCAACAACTGGAGAAGGG - Intronic
1146382077 17:32338181-32338203 TGTTCTCAAAAACCAAAGAAAGG + Intronic
1146942548 17:36853985-36854007 GGTTACCAGAGACTAGAGGAAGG + Intergenic
1147770811 17:42866750-42866772 GGACATCAAAAACTAGAGGAGGG + Intergenic
1151138445 17:71969802-71969824 TGTGAGCAACTACTAGAGGATGG + Intergenic
1154944260 18:21146196-21146218 TGTAATCAAAATCTAAAGAAAGG - Intergenic
1155445581 18:25908754-25908776 CTTTTTCAAAAAATAGAGGAGGG - Intergenic
1157768776 18:50326001-50326023 TGTTATCAGTAGCTGGAGGAAGG - Intergenic
1159658860 18:71068051-71068073 TCTTATCACCATCTAGAGGAAGG + Intergenic
1159980752 18:74776585-74776607 TGTTACCAAAAAGTAGGGGTAGG - Intronic
1160064363 18:75561411-75561433 TTGTATCAAGACCTAGAGGAGGG - Intergenic
1165460076 19:35939264-35939286 TGTGACCAAAAGCCAGAGGAAGG - Intronic
1168249151 19:55131729-55131751 TATTATGAAAAACTAGCGGTGGG + Intergenic
927941155 2:27103672-27103694 TGTTATCAAGACCTTGAGGTGGG - Intronic
929132627 2:38593542-38593564 TAGTATCAAAAACCAGTGGAGGG + Intronic
929972031 2:46588665-46588687 TGTTATAAAAAATTAGTGGAAGG - Intronic
930377485 2:50586237-50586259 TGTGAGCAAAAACTTGAAGAAGG - Intronic
930553635 2:52868209-52868231 TGTTATCATTAATTAAAGGAGGG + Intergenic
930864288 2:56107635-56107657 TGTTATAAAATGCTAAAGGAAGG + Intergenic
931774611 2:65529888-65529910 TGATATCAAAAACTTGGGGCTGG + Intergenic
932536108 2:72597286-72597308 TGTTATAAGGAACTAGAGGGAGG + Intronic
933142407 2:78809180-78809202 TGATATCAAAAACAATAGTAAGG + Intergenic
933678922 2:85081429-85081451 TATTATTAGAAACTAGAGGAAGG - Intergenic
935782143 2:106517655-106517677 TGTTATTAAAAACTATAGGAAGG - Intergenic
936882585 2:117272066-117272088 TGTTATCAATTACTAAATGAAGG - Intergenic
936976732 2:118228262-118228284 AGTTATTAAAAACCAGAGTAAGG - Intergenic
937405005 2:121619492-121619514 TGTTGTAAAAAACTATAGGCTGG + Intronic
938153540 2:128907263-128907285 AGTTATCAAAGATTAGAGGTAGG - Intergenic
942091840 2:172499675-172499697 TGATATCAAAAACTAAAGTTGGG + Intronic
942242432 2:173975099-173975121 TGTTATACAAAACTAGAGGGAGG - Intergenic
943660124 2:190550638-190550660 TGCTATTAAAAAATAGAGAAGGG - Intergenic
945722799 2:213439434-213439456 TGTTATTTAAAACTGGAAGAAGG + Intronic
946296603 2:218788752-218788774 TGTTAACAAAATCCAGAAGAAGG - Intronic
946665623 2:222046921-222046943 TGTCTTAAAGAACTAGAGGATGG + Intergenic
1173084873 20:39906224-39906246 TGTTTTCATAAAAAAGAGGAAGG - Intergenic
1177329384 21:19636715-19636737 TGTTAGTAAAAATTAGAAGAGGG + Intergenic
1178107906 21:29341213-29341235 TGTCATAAAAGACTAAAGGATGG + Intronic
1178797750 21:35760834-35760856 TATTATGAAAAGGTAGAGGAAGG - Intronic
1180726998 22:17953618-17953640 TTTTCTCAAACACTAGAGCAAGG - Intronic
1183031720 22:35111353-35111375 CATTATGAAAAACTCGAGGAAGG - Intergenic
1183985754 22:41569245-41569267 TGTTACCAAAAAAAAGAAGACGG - Intronic
1185389565 22:50551649-50551671 TGATGTAAAAAACTAGAGGCTGG + Intronic
950061159 3:10072058-10072080 TGCTATCAAAAACTAGATCTTGG - Intronic
950842948 3:15985662-15985684 TATTCTCAAAAAATTGAGGAGGG - Intergenic
950989738 3:17419988-17420010 ATTTATCAAGAACTAGGGGAAGG - Intronic
951567775 3:24028806-24028828 AGTTATCAGAATCTAGAGAAGGG - Intergenic
951590489 3:24259112-24259134 ATTTATCAAAAATTCGAGGATGG + Intronic
951883326 3:27500718-27500740 AATTATTAAAAACTAGAGAAAGG - Intergenic
952791384 3:37203371-37203393 TGTTATCATAAACTGCAGGTGGG + Intergenic
956708798 3:72022538-72022560 TGTAATTAAAAGCTAGAGCAAGG - Intergenic
956826164 3:72998066-72998088 TCTTCTCAAAATCTAGATGAAGG - Exonic
957391147 3:79571766-79571788 AGTTATCAACACCCAGAGGAAGG + Intronic
957748350 3:84375410-84375432 TTTTATTAAAAAATAAAGGAGGG - Intergenic
958128546 3:89387968-89387990 TGTTATCAAAAAATCGGGGGAGG + Intronic
959054962 3:101558468-101558490 TGTTTTCAAAGACAAGTGGATGG - Intergenic
959139331 3:102466243-102466265 TGTTATTGAAAAACAGAGGAGGG + Intronic
959926116 3:111923651-111923673 TGGTTGGAAAAACTAGAGGATGG - Intronic
959929303 3:111961407-111961429 TGTTATCAACAGCTTGTGGAAGG + Intronic
960747459 3:120906276-120906298 TATTATCACAAACTAAATGATGG - Intergenic
961190564 3:124957746-124957768 TGTTATTAAAAAATATAGGCTGG - Intergenic
962708075 3:138063847-138063869 TGCTATCAAAAACCAAAGAATGG + Intronic
963946660 3:151153050-151153072 TGTTTTCATATACTAGAGCAAGG + Intronic
965632982 3:170752314-170752336 TGTCATCAACAACTAGAGAGAGG - Intronic
966770669 3:183500963-183500985 TGTTATGGAAAAGTAGAGGCTGG - Intronic
968321006 3:197768428-197768450 TCTTACCAAAACCTATAGGAGGG - Exonic
970873356 4:20842001-20842023 TGTTACAAAGAACTAGAGCAGGG - Intronic
971866949 4:32184702-32184724 TTTTATCACAAATTATAGGAAGG - Intergenic
972085639 4:35210836-35210858 TATTATTAAAAAATGGAGGAAGG - Intergenic
972869825 4:43283923-43283945 TGTTATCAAAAACTGAAAGAGGG - Intergenic
973212206 4:47628624-47628646 AGTTGCCAAAAACTAGGGGATGG - Intronic
977894936 4:102352646-102352668 AGTTATCAAAATGTAGATGATGG + Intronic
977907343 4:102493369-102493391 TGTTATCAAAAAAAGGAAGAAGG - Intergenic
979147505 4:117263445-117263467 TGTCACCAAAAACTAAAGTAAGG - Intergenic
979662002 4:123267191-123267213 AGTTTCCAAAAACTAGTGGAGGG - Intronic
981962676 4:150560448-150560470 TGTGACCAAAAACTAAATGAAGG + Intronic
983574445 4:169245805-169245827 TGTTACCAGAAACCAAAGGAAGG + Intronic
983748869 4:171238163-171238185 TCTCCTCAAAAACTTGAGGATGG + Intergenic
984196071 4:176659708-176659730 TGTTATTGGAAGCTAGAGGAAGG - Intergenic
984295714 4:177852283-177852305 TGTTATCAAAAGATAAAGAATGG + Intronic
984409176 4:179372922-179372944 TGTTATTGGAAACCAGAGGAAGG - Intergenic
985203597 4:187508592-187508614 TTTTTTAAAAAAGTAGAGGAAGG - Intergenic
986439607 5:7768206-7768228 TGTTATCATAAACTCCAGTAAGG + Intronic
986936019 5:12887717-12887739 TGTTACTAGAAACTGGAGGAAGG - Intergenic
987292698 5:16523623-16523645 TGCTTTCAAAGAATAGAGGATGG - Intronic
987690851 5:21264959-21264981 TGTTATCAAATGCAAGAGGAAGG + Intergenic
987847969 5:23312460-23312482 AATCATCAAAAACTAGAAGATGG + Intergenic
988180918 5:27791940-27791962 GTTTTTCAAAAACTAAAGGATGG - Intergenic
994138094 5:96310465-96310487 TTTTACAAAAAATTAGAGGAAGG - Intergenic
994919677 5:106027847-106027869 TGTTTTAAATCACTAGAGGATGG + Intergenic
996769515 5:127071518-127071540 TGTTATGCAATACTAGGGGAAGG + Intronic
996888293 5:128385703-128385725 TGTTATTAAAAAGTAGATGCTGG - Intronic
996984594 5:129543867-129543889 TGTTATTTATAACTAGAGAATGG + Intronic
998728010 5:145041230-145041252 TGGTATTGAAAACTAGGGGATGG + Intergenic
998876855 5:146608887-146608909 TGTTACAAAAAAATAGAGGAGGG + Intronic
999792592 5:154955364-154955386 TGTTATGGAAAACTATAGCAAGG - Intronic
999884934 5:155911782-155911804 TGGCATGAAAAAATAGAGGATGG + Intronic
1000114898 5:158144680-158144702 GGTAATCAAAAAGTAGATGAGGG - Intergenic
1000974214 5:167747407-167747429 TGTTATCACAAACTTGGGCAGGG - Intronic
1000998761 5:167985231-167985253 TTTGATCAAAAGCTAGGGGAAGG - Intronic
1001221015 5:169901054-169901076 TGTGACCAAAAAATAGAGGCCGG + Intronic
1002930725 6:1633257-1633279 GATTATCTAAAATTAGAGGAAGG - Intronic
1003594841 6:7465070-7465092 TGTTTTTAAAAAGTGGAGGATGG + Intergenic
1003667187 6:8122233-8122255 TGTTACCAGAAGCTAGAGGAAGG - Intergenic
1003845235 6:10166928-10166950 TTTTAGCAAAGACTAGAAGAAGG - Intronic
1003854750 6:10261973-10261995 TGTCATGAAAAACTACAGGTGGG - Intergenic
1004178369 6:13360198-13360220 TGTTATGTAAAACAAAAGGACGG + Exonic
1005358315 6:25006677-25006699 TGTTATCAAAAACTTGTGCAAGG - Intronic
1006592495 6:35168817-35168839 TGTGATCAAAAGCCAGTGGAAGG - Intergenic
1006958227 6:37897128-37897150 TGTAATCAACAGCTAGAGCAAGG + Intronic
1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG + Intronic
1008523157 6:52381642-52381664 TGTTAACAAAAATTGGAGTAGGG - Intronic
1008943087 6:57068818-57068840 TGTTACCAGAATGTAGAGGAAGG - Intergenic
1013147528 6:107409272-107409294 AGTTATAAAAATCAAGAGGATGG - Intronic
1013474508 6:110495086-110495108 TGCTATCAAAGACTAGGAGAAGG + Intergenic
1014726034 6:124972803-124972825 GGTTATCAAAGAATATAGGAAGG - Intronic
1014897535 6:126921555-126921577 TCTTAGGAAAAACCAGAGGAGGG - Intergenic
1015048024 6:128802360-128802382 TATGTTCAAAAGCTAGAGGAAGG - Intergenic
1015263227 6:131262345-131262367 TGTTATCATAAACCTGAGTAAGG + Intronic
1015357920 6:132301695-132301717 TGTGATCAAAAACTAGCAAAAGG + Intronic
1016283173 6:142442927-142442949 TGTTTTCAAATAATATAGGAAGG - Intronic
1017210692 6:151852374-151852396 TATTATGAAAATCAAGAGGAAGG - Intronic
1017424919 6:154310364-154310386 TTTTTTTGAAAACTAGAGGAAGG + Intronic
1017435566 6:154412489-154412511 TTCTATCAGAAACTGGAGGAAGG - Intronic
1018052121 6:160019424-160019446 TGTTACCAAAAATCAGAGGAGGG + Intronic
1018130586 6:160728823-160728845 TATTTTCACAAACTTGAGGAAGG + Intronic
1020690981 7:11354346-11354368 CCTTATCAAAAACAATAGGAGGG - Intergenic
1021233187 7:18110354-18110376 TGTTATCAAAGTACAGAGGAGGG + Intronic
1021243532 7:18234353-18234375 TGTTATAGAAATCTAGAGAAGGG + Intronic
1021804329 7:24340181-24340203 TGTTCTCAGAATCTAGAAGAAGG + Intergenic
1024321947 7:48079509-48079531 TGTCTTGAAAAACTATAGGAGGG - Intergenic
1024715678 7:52077091-52077113 TGTAATCAAAATCTTCAGGAGGG - Intergenic
1025888512 7:65622227-65622249 TGTTTTCAAAAAAAAGAGAAGGG + Intergenic
1027593401 7:80141904-80141926 TGTTATCAAAAACTAGAGGAAGG - Intronic
1027847339 7:83398641-83398663 TGTTTTAAAAAACAAAAGGATGG + Intronic
1028022483 7:85793253-85793275 TTTTGTCAAAAAATAGGGGAAGG + Intergenic
1029243646 7:99182634-99182656 TCTGATCAAGAACTAGAGGCAGG - Intronic
1031270072 7:119637124-119637146 TGTTATCAAAAAAGACAGAAAGG - Intergenic
1031892586 7:127311908-127311930 TTATTTCAAAAAATAGAGGAGGG + Intergenic
1032823164 7:135543366-135543388 TTGTCTCAAAAACTTGAGGATGG - Intergenic
1034083178 7:148299376-148299398 TTGCATCAGAAACTAGAGGAGGG + Intronic
1034673442 7:152874118-152874140 GGTGATTAAAAACTAGATGACGG - Intergenic
1036067111 8:5393494-5393516 TGGAATAAGAAACTAGAGGAAGG + Intergenic
1037555946 8:20022554-20022576 TGTTATTGAAAACTGGAGAAAGG + Intergenic
1038373871 8:27018471-27018493 TTATAACAAAAACAAGAGGAAGG + Intergenic
1038951625 8:32421270-32421292 TGTTATCAAGAAGTAGGGTAGGG + Intronic
1038972488 8:32651809-32651831 AGTTACCAAGAACTAGAAGAAGG - Intronic
1039367845 8:36950477-36950499 TGTTTTCAAAAACAAGAGGAGGG - Intergenic
1044440992 8:92223267-92223289 TTTTATCAAAGGCTAGGGGAGGG + Intergenic
1044972773 8:97636046-97636068 TGTTTTTAGAAACTGGAGGAAGG - Intergenic
1045226761 8:100254925-100254947 TGCTATGAAAAATTAGAGGTGGG - Intronic
1045825833 8:106396818-106396840 TGTTAGGAGAAACTAGATGAAGG + Intronic
1045883604 8:107069720-107069742 TGCTATGAAACCCTAGAGGAAGG + Intergenic
1046289606 8:112139517-112139539 TGTAATCATAAACTATTGGATGG + Intergenic
1046505304 8:115129428-115129450 ACTTATCGCAAACTAGAGGAAGG - Intergenic
1047651692 8:126929781-126929803 TGTGATGAAAAACTATTGGAGGG + Intergenic
1050902386 9:10964283-10964305 TGTTCTCAATAGCTAAAGGAAGG - Intergenic
1056221103 9:84451415-84451437 AGTTATCAAAACCCAGATGAGGG - Intergenic
1056804240 9:89715979-89716001 TGTTATAGAAAATTGGAGGAAGG - Intergenic
1057759711 9:97862347-97862369 TCTTAACAAAAAATAGGGGAGGG + Intergenic
1058257663 9:102789545-102789567 TATTTTCAAAAAATAGAGTATGG + Intergenic
1059599456 9:115760601-115760623 TGTTATCAGAAATAAGATGATGG + Intergenic
1060614776 9:125002814-125002836 AGTAATAAAAAACTGGAGGAAGG + Intronic
1186693718 X:12006818-12006840 TGTGGTCCGAAACTAGAGGAAGG + Intergenic
1186698016 X:12058246-12058268 AGTTAACAAAAACTCCAGGAAGG + Intergenic
1186828924 X:13370874-13370896 TATTCTTAAAAACTAGAGGAGGG + Intergenic
1186909554 X:14147633-14147655 TGTTATGAGAATATAGAGGATGG - Intergenic
1187525355 X:20049106-20049128 GGTTATCAGAGACTGGAGGAGGG - Intronic
1192344687 X:70291346-70291368 TGGTATGAAAAACAAAAGGATGG + Intronic
1193087108 X:77456610-77456632 TGTTATCTAAAATGATAGGAAGG - Intronic
1195048704 X:101078076-101078098 TGTTATAGAAAATTGGAGGAGGG + Intergenic
1196121123 X:112051784-112051806 GGTTGTCAAAAACTAGGGGTGGG - Intronic
1196514496 X:116553687-116553709 TGTTATGGAAATCTAGAGAAGGG - Intergenic
1197918756 X:131565500-131565522 TGAAGTCAAACACTAGAGGATGG + Intergenic