ID: 1027597325

View in Genome Browser
Species Human (GRCh38)
Location 7:80190039-80190061
Sequence CTGAATATACAGAATTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 577}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027597325 Original CRISPR CTGAATATACAGAATTATAA AGG (reversed) Intronic
901103166 1:6735167-6735189 TTGAATCCACAGTATTATAAAGG - Intergenic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
901623703 1:10610644-10610666 CTGAAAATACAAAATTATCCAGG - Intronic
901909953 1:12448620-12448642 TTGATTATAAAGAATTATGAAGG - Intronic
901928543 1:12582715-12582737 CTGTATACACAGGATGATAAGGG - Intronic
902846101 1:19111779-19111801 CTGAAAATACAAAATTAGACAGG - Intronic
906229059 1:44145291-44145313 CTGAATATCCAGCCTTAAAATGG + Intergenic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906675690 1:47692124-47692146 CTGAAAATACAAAATTAGCAGGG - Intergenic
908081263 1:60581196-60581218 CTGAATAGTCAAAATTATCATGG - Intergenic
908243408 1:62207871-62207893 CTGAAAATACAAAATTATCTGGG - Intronic
908619101 1:65955945-65955967 CTTAATATGCTGAATTATAGTGG - Intronic
909413696 1:75381437-75381459 CTGAACATCCAGAATTATGGAGG + Intronic
909669730 1:78174655-78174677 CTTAATAGAAAGAATTATTAAGG + Intergenic
910116013 1:83732422-83732444 CTCTATATAGAGAATTAAAATGG + Intergenic
910177060 1:84442280-84442302 CTGAAGCTACTGAATTACAATGG + Intergenic
910270690 1:85390867-85390889 CAGATAATATAGAATTATAATGG + Intronic
910485091 1:87704350-87704372 AGGAACAGACAGAATTATAATGG + Intergenic
911471942 1:98329937-98329959 CTGATTATACAGTTTAATAAAGG + Intergenic
911640812 1:100286733-100286755 CTGAATAGACAGACTAATACTGG - Intronic
911643546 1:100315009-100315031 CTGAATGTATAGCATTTTAAAGG - Intergenic
911751043 1:101498474-101498496 CTAAAAATACAGAATTATCCTGG + Intergenic
911896539 1:103442689-103442711 CTGAATTTGCTGCATTATAAGGG - Intergenic
911998369 1:104797104-104797126 CTGAACATTCAGAGTTATATGGG - Intergenic
912578857 1:110702169-110702191 CTGAAAATACAGAATTTAGAAGG - Intergenic
912602809 1:110955225-110955247 CTGAATATAAGGAATAAGAAAGG - Intronic
914399120 1:147299728-147299750 CTGATTCTACAAAAATATAAGGG + Intergenic
914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG + Intronic
914823161 1:151120915-151120937 CTGAATATACAAAATTAGCCGGG - Exonic
914977109 1:152376379-152376401 GTGCATTTAGAGAATTATAAAGG - Intergenic
915233309 1:154462272-154462294 CTGAGGATACAGAATAATCATGG - Intronic
915401948 1:155628665-155628687 CTGAACATCCAGAATTATGGAGG - Intergenic
917021864 1:170597910-170597932 CAAAATATACTGAATTTTAAAGG - Intergenic
917414337 1:174792969-174792991 CTGAAAATACAAAATTAGCAGGG + Intronic
918868595 1:189936213-189936235 TTGAATATACATACTGATAATGG - Intergenic
919242114 1:194927580-194927602 CATAATATAGAGAATTAGAAAGG - Intergenic
920161231 1:203999172-203999194 CTGAATTTAGAGAATCAGAAGGG + Intergenic
920455176 1:206095653-206095675 CTGAAAATACAAAATTAGCAGGG + Intronic
920629412 1:207637099-207637121 CTGAACATCCAGAATTATGGAGG - Intronic
921118514 1:212116716-212116738 CAGAATATAGAGTCTTATAATGG + Intergenic
921622639 1:217343023-217343045 CTGAAGTCACAAAATTATAAGGG - Intergenic
921648642 1:217650098-217650120 CTAAATATACAAAATTATCCAGG - Intronic
921735793 1:218626629-218626651 CTAAAAATACAAAATTATCAGGG + Intergenic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
923289974 1:232535352-232535374 GTGAAAATAGAGATTTATAATGG - Intronic
923878712 1:238079284-238079306 AAGAATATAAAGGATTATAAGGG - Intergenic
923945916 1:238887402-238887424 CTGAATAGAAAGAATCATACTGG + Intergenic
1063275968 10:4568337-4568359 CTGAAAATAAATAATTACAAAGG + Intergenic
1063453487 10:6166988-6167010 CTGAAAATACAAAATTAGCAGGG - Intronic
1063861660 10:10315486-10315508 ATGAAAAGACACAATTATAAAGG + Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1064072877 10:12245670-12245692 CTGAATAGACAGAGATCTAAAGG - Intronic
1064898038 10:20261691-20261713 CTGAAAATACAAAATTATCCGGG + Intronic
1066121500 10:32292435-32292457 CTCAATATACAAAATGTTAATGG + Intronic
1066166751 10:32796914-32796936 TTAAATATACAGAATTCTAGGGG + Intronic
1066383559 10:34922010-34922032 CTGAAAATACAAAATTATCTGGG + Intergenic
1066527657 10:36298485-36298507 CTAAATATTCAGAATTAAACTGG - Intergenic
1066553323 10:36583639-36583661 CTGAATAGACAGTATGAAAAGGG - Intergenic
1066999630 10:42595954-42595976 TTGAATAAACAGCATTGTAAAGG + Intronic
1067265433 10:44738363-44738385 CTGACTTTACAGAAATAAAAAGG + Intergenic
1068269260 10:54698638-54698660 TTGAAAATAGAGAATTAAAAAGG - Intronic
1068860582 10:61843917-61843939 TTTAATATAAAGAATTAAAAAGG + Intergenic
1069062265 10:63906507-63906529 CTAAAAATACAAAATTATATGGG - Intergenic
1069223605 10:65913591-65913613 GTAAAAATACAGCATTATAATGG + Exonic
1069261956 10:66409806-66409828 CTGATTATATAGAATTAGAAAGG + Intronic
1069312364 10:67054112-67054134 GTGAATATGTGGAATTATAAAGG - Intronic
1070272893 10:74975345-74975367 TTTAATAAATAGAATTATAAAGG - Intronic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071380474 10:85054107-85054129 CTGAAATTACAGATTTAAAATGG - Intergenic
1072057004 10:91768590-91768612 CTGCATATACAATGTTATAATGG - Intergenic
1072771930 10:98148535-98148557 AGGAATATACAAAATAATAAAGG - Intronic
1073383030 10:103095705-103095727 CTTAATAGACAGAAATAAAAGGG - Intronic
1073972946 10:109065153-109065175 CTAACTATACAGAATTCTACAGG - Intergenic
1074484689 10:113863791-113863813 CTGATTCTACAGAAATAAAAAGG + Intronic
1074702875 10:116107867-116107889 CAGAATATGCAGAATTAAAATGG + Intronic
1075327571 10:121546796-121546818 TGGAATGAACAGAATTATAAAGG + Intronic
1076162852 10:128259027-128259049 ATGAATATTAAGAATTTTAAAGG - Intergenic
1077621692 11:3730523-3730545 CTGAATATACAAAATTAGCTGGG - Intronic
1077626797 11:3779478-3779500 CTAAAAATACAAAATTAGAAGGG + Intronic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1079524758 11:21372343-21372365 CTGAATACACAGAATTAATGGGG + Intronic
1079715818 11:23743067-23743089 CAGAATATAAATAATTTTAATGG - Intergenic
1080377740 11:31733531-31733553 CTGACTCTACAGAAGTAAAAAGG + Intronic
1080483047 11:32672801-32672823 CTAAATAGACAGACTTTTAAGGG + Intronic
1080636499 11:34128634-34128656 CTGAAAATACTGAAATAAAATGG + Intronic
1082667986 11:55998097-55998119 TTAAATATAAAGAAATATAATGG - Intergenic
1082668062 11:55999339-55999361 TTAAATATAAAGAAGTATAATGG + Intergenic
1083370575 11:62175921-62175943 ATGAATATACAAAATCAAAAAGG - Intergenic
1083393175 11:62370479-62370501 CTGAACATCCAGAATTATGGAGG - Intronic
1085451020 11:76633359-76633381 CTGAATATACCTTATTATATAGG - Intergenic
1085631829 11:78124864-78124886 CTGAGGATACAAAATGATAAAGG - Intronic
1085964523 11:81504934-81504956 TTGAAAATACAGAAATATAATGG + Intergenic
1087588868 11:100158688-100158710 CTGAAAATACCAAGTTATAATGG + Intronic
1087655412 11:100916975-100916997 CAGAATATACAGTATTATACAGG + Intronic
1087724513 11:101702507-101702529 CTGAACATCCAGAATTATGGAGG + Intronic
1087793827 11:102434330-102434352 CTGAATATTAAGAATCATTAGGG - Intronic
1087883817 11:103452671-103452693 CAAAATATACAGAATTTTGAAGG - Intronic
1087892776 11:103553773-103553795 CTGAGTATAGAGGATTAGAAAGG + Intergenic
1088267949 11:108005400-108005422 CTAAAAATACAGAATTATCCAGG - Intergenic
1089471359 11:118723011-118723033 CTGAACATCCAGAATTATGGAGG - Intergenic
1089825490 11:121272261-121272283 CTGATATTACAGAAATATAAAGG + Intergenic
1090720048 11:129463597-129463619 CTGATACTACAGAAATATAATGG - Intergenic
1092116338 12:6011291-6011313 CTGAATACACAGATTCCTAAAGG + Intronic
1092228251 12:6762931-6762953 CTGAAAATACAAAATTATCCAGG + Intronic
1092588813 12:9930321-9930343 CTCAATATATAAAATTTTAAGGG + Intronic
1092719719 12:11429680-11429702 CTGAATATGTTGAATTATATGGG + Intronic
1093398758 12:18716358-18716380 CTGAATATGCAGTTTTGTAAAGG - Intronic
1094755065 12:33458865-33458887 CTGATTCTACAGAAGTAAAAAGG + Intergenic
1095582738 12:43819042-43819064 CTAAAGATACAGAATTGTACAGG + Intergenic
1095701430 12:45194840-45194862 CTTAAAAAACATAATTATAATGG - Intergenic
1095760160 12:45823616-45823638 CTGATACTACAGAAATATAAAGG + Intronic
1095914954 12:47468661-47468683 CTTAATATAAAAAATTATTAAGG + Intergenic
1096000673 12:48127302-48127324 GAGAATATGCAGAATTATAAGGG - Intronic
1096887502 12:54732306-54732328 CTGAACATGCAGAAAAATAATGG - Intergenic
1096967407 12:55639199-55639221 CTGAAAATACAGAATTAGCCGGG - Intergenic
1097330664 12:58329458-58329480 CTGAACATCCAGAATTATGGAGG - Intergenic
1097986794 12:65791668-65791690 CTGAGAAAAGAGAATTATAATGG - Intergenic
1098567420 12:71951862-71951884 CTGAATATACAAAATTAACCAGG + Intronic
1098628002 12:72697080-72697102 CTGAAAATACAGAATTAGTCAGG - Intergenic
1098695093 12:73542440-73542462 CTTAATATCCAGAATTAACAAGG + Intergenic
1098855417 12:75647312-75647334 CAGAATATACAGAATATAAAGGG + Intergenic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099064839 12:77962860-77962882 ATGCACATACATAATTATAATGG - Intronic
1099422263 12:82475464-82475486 CTGAATTTAAAAAACTATAAAGG - Intronic
1100479628 12:94965638-94965660 CTGAAAATACAAAATTAGCAGGG + Intronic
1100802917 12:98252103-98252125 CTGAAAATACAAAATTAGCAGGG - Intergenic
1101560179 12:105849706-105849728 ATGAATATACAGAATATTTAAGG - Intergenic
1101982532 12:109420118-109420140 CTGAATATACAGAAACAGAGTGG - Intronic
1102713413 12:114948887-114948909 CTGAAAATCCAGAATTTTCAGGG + Intergenic
1103202861 12:119102918-119102940 CTGAGTATACAGTATTTTTATGG - Intronic
1106238962 13:27892775-27892797 CTGATTTTACAGAAATAAAAAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1107702683 13:43063817-43063839 AAGAATAAACAAAATTATAAGGG + Intronic
1109163610 13:59006541-59006563 CTCAAAATAGAGAATCATAATGG - Intergenic
1109651991 13:65339256-65339278 ATGAAAGTACAGAATTAGAAAGG + Intergenic
1110121469 13:71887057-71887079 ATGAAAATAAAGAATAATAAGGG - Intergenic
1110437519 13:75491915-75491937 CTGAATTTAGAGAATTATAAAGG + Intergenic
1110811505 13:79816078-79816100 CTGATCATACAGAAATAAAAGGG - Intergenic
1111010627 13:82309759-82309781 CTGAATCAACAGAAATACAAAGG - Intergenic
1112906985 13:104434788-104434810 CTGAAAATACAAAATTAGACGGG + Intergenic
1112922121 13:104626737-104626759 TTTAATATAGTGAATTATAAAGG + Intergenic
1113276154 13:108732835-108732857 CTGGATATACAGGATTTTGAAGG + Intronic
1113494728 13:110717664-110717686 CTGAAAATACAGAATTAGCCGGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114954391 14:27799105-27799127 CTAAATATATAGAATTATGGGGG - Intergenic
1115052640 14:29082869-29082891 CTGAATGTAAATAATTGTAAAGG + Intergenic
1115226484 14:31108249-31108271 CTGAAAATACAGAATTAGCCAGG - Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116279971 14:42893399-42893421 ATGAAAATATAAAATTATAATGG - Intergenic
1117648686 14:57879861-57879883 CTAAATATAGAGTTTTATAATGG - Intronic
1117769466 14:59118462-59118484 CTGAATTTACAAATTTAGAAAGG - Intergenic
1118067644 14:62209212-62209234 AAGAATATTCAGAATTATAGAGG - Intergenic
1118673554 14:68157697-68157719 CTGAATAAAAACAATAATAATGG + Intronic
1118828215 14:69403880-69403902 CTGAAAATACAAAATTATTTGGG + Intronic
1119056350 14:71425072-71425094 CTGATTCTACAGAAATAAAAAGG - Intronic
1119540858 14:75437438-75437460 CTGAAGAGAGCGAATTATAACGG - Intronic
1120908532 14:89643281-89643303 CTAAAAATACAAAATTAGAAGGG + Intergenic
1121398727 14:93652648-93652670 CTTAATATATTGAATTATACTGG + Intronic
1123170102 14:106364759-106364781 CTGAATATCTAGAATTAGAGGGG - Intergenic
1123198765 14:106641724-106641746 CTGAATTTACAGGCTCATAAGGG + Intergenic
1202895485 14_GL000194v1_random:5265-5287 CTGCAGAGACAGAATTAAAAGGG + Intergenic
1123517835 15:21046052-21046074 CTGAAAATACAGAATTAGCCGGG + Intergenic
1123707837 15:22963327-22963349 CTAAAAATACAGAATTAGATGGG + Intronic
1123916691 15:25037647-25037669 CAGAATATACACAGTTAGAATGG - Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124082054 15:26508621-26508643 GGAAATATAAAGAATTATAAGGG + Intergenic
1124465129 15:29931514-29931536 TTGAACATATAGAATTAGAATGG - Intronic
1124616215 15:31244230-31244252 CTCAATATACATAAATAAAAGGG - Intergenic
1124837738 15:33211734-33211756 TTGAAAGTACAGAATTCTAAGGG - Intergenic
1125839756 15:42789093-42789115 CTGAAAATACAATTTTATAAAGG + Intronic
1126241699 15:46452385-46452407 CTGCATCTAGAGATTTATAAAGG + Intergenic
1126519447 15:49574697-49574719 CAGAAGATCCAGAATTAGAAAGG - Intronic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1127426397 15:58863210-58863232 CTGAAAATACAGAATTAGCCAGG - Intergenic
1128401229 15:67283287-67283309 CTGTATATACATTATTACAAAGG - Intronic
1128954293 15:71923673-71923695 CTGATATTACAGAAATATAAGGG - Intronic
1129147145 15:73658709-73658731 TTGAATTTACAGAATTATCTGGG + Intergenic
1129420752 15:75424271-75424293 CTGAAAATACAAAATTAGACAGG + Intronic
1129991456 15:79967375-79967397 CTGAAAATACAAAATTAGCAGGG - Intronic
1131205638 15:90443641-90443663 CTGAAGATAAATAATTAAAACGG - Intronic
1131597737 15:93814999-93815021 CTTAATATTCAGCATTATTAAGG + Intergenic
1132370729 15:101295755-101295777 ATGAATATTCAGAAGTCTAAAGG - Intergenic
1133455209 16:5935877-5935899 CTGAATTCACAGAGGTATAATGG + Intergenic
1133488681 16:6246036-6246058 CTGAATAATCAGAATTATTGTGG + Intronic
1133909482 16:10052029-10052051 GGGAAACTACAGAATTATAATGG + Intronic
1134470566 16:14521635-14521657 CTAAAAATACAGAATTAGCAGGG + Intronic
1134563950 16:15235061-15235083 CTAAAAATACAGAATTAGATGGG + Intergenic
1134738544 16:16521635-16521657 CTAAAAATACAGAATTAGATGGG - Intergenic
1134928956 16:18190525-18190547 CTAAAAATACAGAATTAGATGGG + Intergenic
1135008799 16:18854472-18854494 TTGAAAGCACAGAATTATAAAGG + Intronic
1135271184 16:21071201-21071223 CTAAAAATACAGAATTAGCAGGG - Intronic
1135886559 16:26314973-26314995 GTTAATATCCAGAATTATAGGGG + Intergenic
1136930511 16:34414048-34414070 CTGAACATCCAGAATTATGGAGG - Intergenic
1136974063 16:34997760-34997782 CTGAACATCCAGAATTATGGAGG + Intergenic
1139086371 16:63591489-63591511 ATGAATATTCAGAATAAAAATGG + Intergenic
1139677969 16:68538538-68538560 CTAAATATACAAAATTAGACGGG + Intronic
1139764423 16:69215002-69215024 CTGAAAATACAGAATTAGTCAGG - Intronic
1140563633 16:76013635-76013657 GTTAATATCCAGAGTTATAAAGG - Intergenic
1142293763 16:89205923-89205945 CTGAATCTGCAGATTTATATGGG + Intergenic
1142463035 17:108752-108774 CTGAAAATACAGAATTAGCCAGG - Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144516579 17:15921755-15921777 CTGAATTCACAAAATTATTAGGG + Intergenic
1144933934 17:18882348-18882370 CTAAAAATACAGAATTATCTGGG + Intronic
1146990513 17:37266671-37266693 CAGAATTTACAGAAATGTAAAGG - Intronic
1147041262 17:37721197-37721219 CACAATAAACAGATTTATAATGG - Intronic
1147290412 17:39437771-39437793 CTGAAAATACAAAATTAGCAGGG + Intronic
1147468084 17:40627593-40627615 CTGAGTACACAAATTTATAATGG + Exonic
1148428195 17:47619143-47619165 CTTAATATCCAGACTAATAAAGG + Exonic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1149719540 17:58829201-58829223 CTGAATATACAAAATTAGCCAGG - Intronic
1150991310 17:70262981-70263003 CTGAATGTACAGAGTTATTGTGG + Intergenic
1203175624 17_KI270729v1_random:10895-10917 CTGAATCAACAGAAGTGTAATGG - Intergenic
1153143809 18:2005598-2005620 CAGAATAACTAGAATTATAAAGG + Intergenic
1153394372 18:4601947-4601969 CTGAAAATACAGAAAAGTAAGGG - Intergenic
1155082171 18:22420945-22420967 TAGAATACACAGATTTATAAAGG + Intergenic
1155098605 18:22585538-22585560 CTGAAGAAACAGAAGTCTAAGGG + Intergenic
1155369854 18:25087287-25087309 CTGAAAATACATCATCATAAAGG + Intronic
1155606186 18:27608662-27608684 CTGAAAATACAGAATTAGCCCGG + Intergenic
1155638791 18:27987428-27987450 CTTAGTATACAGATTTAGAAAGG + Intronic
1155664102 18:28286270-28286292 CTGAATATATAATATTATGAAGG + Intergenic
1155936925 18:31763903-31763925 CTGAAAATACAAAATTAGACGGG + Intergenic
1155961350 18:31998003-31998025 CTGAAAATACAGAATTAGCCAGG - Intergenic
1156091635 18:33478767-33478789 TTAAATATACATAATTATTAGGG - Intergenic
1156416805 18:36902923-36902945 CAGAAGCTACAGAATTCTAAGGG - Intronic
1156633897 18:39004079-39004101 CTGTATATACAGATCTGTAAAGG + Intergenic
1157041163 18:44040975-44040997 CTGAATATACAATATTGTGAAGG - Intergenic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1159360959 18:67402041-67402063 CTGTATAGACAGGATTAGAAGGG + Intergenic
1159444253 18:68521339-68521361 CTGAATATTCAGACATATAAAGG + Intergenic
1159758450 18:72394832-72394854 CTGAAAATACAAAATTAGCAGGG + Intergenic
1159964916 18:74585831-74585853 CTGAATATACAAAATTAACTGGG + Intronic
1159989991 18:74894209-74894231 TTGAATATACTGATTTGTAATGG - Intronic
1160439857 18:78881348-78881370 TTGAATATAGAGAAGTACAAAGG - Intergenic
1160675018 19:385627-385649 CTGAACATCCAGAATTATGGAGG + Intergenic
1161215262 19:3091896-3091918 CTGAAAATACAGAATTAGCCAGG - Intergenic
1162716005 19:12634286-12634308 CTGAATATTCATAACTGTAATGG - Intronic
1163873935 19:19850231-19850253 CTGAAAATACAAAATTATCCAGG - Intergenic
1163920578 19:20284779-20284801 CTGAACATCCAGAATTACAGAGG + Intergenic
1164370501 19:27639616-27639638 CTGAACATCCAGAATTATGGAGG - Intergenic
1165606395 19:37108628-37108650 CTGAACATCCAGAATTATGGAGG - Intronic
1165618043 19:37219414-37219436 CTGAAAATACAAAATTAGCAGGG - Intronic
1167825231 19:51966806-51966828 CTAAATATACAGAATTAGCTGGG - Intronic
1167858483 19:52262842-52262864 CTGAATAGACATTATTATAAAGG - Intergenic
926544444 2:14222017-14222039 CAGAACATGCAGAATCATAAAGG - Intergenic
926547956 2:14265194-14265216 CTACATATTCAGAATTCTAAGGG - Intergenic
926665221 2:15514350-15514372 CTGAATAAATAGAAATATAAGGG + Intronic
929280623 2:40073981-40074003 CTGTATATACAGAAAGGTAAGGG + Intergenic
929786680 2:44998552-44998574 CTTAATATTCACAATTATATAGG - Intergenic
930303060 2:49641456-49641478 CTGAAGATATAGAAGTAAAATGG - Intergenic
931084092 2:58809724-58809746 CTAAATATATATATTTATAAAGG - Intergenic
931281799 2:60800696-60800718 CTTCTTATACACAATTATAAAGG - Intronic
931553777 2:63476975-63476997 CTGAAAATGCAGAATTGTTATGG + Intronic
932233924 2:70106113-70106135 CTAAAAATACAAAATTAGAAGGG - Intergenic
933439171 2:82288533-82288555 CTGAATCTCCATAATTCTAAAGG - Intergenic
933611505 2:84440843-84440865 CTGATTCTGCAGAATTGTAACGG + Intronic
933913470 2:86964674-86964696 CTGAAAATACAAAATTAGATGGG - Intronic
934009524 2:87805224-87805246 CTGAAAATACAAAATTAGATGGG + Intronic
935017286 2:99195919-99195941 CTGAAAATACAGAATTAGCCAGG + Exonic
935662199 2:105476699-105476721 TTGAAAAAACAGAATGATAATGG + Intergenic
936964174 2:118111010-118111032 CAGAATATACTTCATTATAAAGG - Intergenic
937678726 2:124621038-124621060 TTGATAAAACAGAATTATAAGGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938270253 2:129963957-129963979 CTGAACATCCAGAATTATGGAGG - Intergenic
939618193 2:144384552-144384574 CTAAATTTAAAGAAGTATAAAGG - Intergenic
939836977 2:147141735-147141757 ATGAATATATAGGAATATAATGG - Intergenic
940525948 2:154813961-154813983 ATGAATATACACATTTTTAAAGG - Intronic
940534040 2:154915670-154915692 ATGAAAATATAAAATTATAAAGG + Intergenic
940792273 2:158041990-158042012 CTGGAAATCCAGATTTATAAAGG - Intronic
941293987 2:163713381-163713403 CTAAATAAACAGCAGTATAAAGG + Intronic
942265925 2:174225387-174225409 CTAAAAATACAAAATTAGAAGGG + Intronic
943085940 2:183311179-183311201 CTGAGTATACAGAACCCTAAGGG - Intergenic
943288532 2:186038008-186038030 AAAAATATACAGAATCATAATGG - Intergenic
943403734 2:187452771-187452793 ATGCATATCCAGAATTAAAAAGG - Intergenic
943458292 2:188136265-188136287 CTGGATAAACAGAACTATATGGG + Intergenic
943474367 2:188336442-188336464 CTGAAGATACAGCATCAAAAAGG + Intronic
943482106 2:188432018-188432040 CTTGATATACAGAATTATATAGG + Intronic
943929010 2:193825681-193825703 TAGAATATACAGAATTTTTAGGG + Intergenic
944670632 2:201991544-201991566 CTGAATATCAGGGATTATAAAGG + Intergenic
945069538 2:205976854-205976876 CTAAAAATACAAAATTATCAGGG + Intergenic
945114150 2:206394283-206394305 CTAAAAATACAGAATTATCCAGG + Intergenic
945290513 2:208122561-208122583 TTTAAAATACAGAAATATAAGGG + Intronic
945483943 2:210371962-210371984 AAGAATAAAAAGAATTATAATGG - Intergenic
945757954 2:213873323-213873345 CCAGATTTACAGAATTATAAAGG - Intronic
946891506 2:224281766-224281788 CTTAATATCGAGAATAATAATGG + Intergenic
947127576 2:226886610-226886632 CTAAAAATACAGAATTTTATAGG + Intronic
947827292 2:233115026-233115048 CTGAAAATACAAAATTAGATAGG - Intronic
1169650165 20:7858183-7858205 CTGAATACACTGTATTTTAAAGG + Intergenic
1170029194 20:11927063-11927085 CTTGATATAAAGAAATATAATGG - Intergenic
1170029347 20:11928940-11928962 CTGTATCAACACAATTATAAGGG - Intergenic
1170116013 20:12860445-12860467 TTGATTATACAGCATTATTATGG - Intergenic
1170137656 20:13092744-13092766 GTGAAACTACAGAAATATAATGG + Intronic
1170306216 20:14941193-14941215 CTGAGACTACAGAATTATTATGG - Intronic
1170562232 20:17568382-17568404 CTGAATATTAAGAAGTGTAAGGG + Intronic
1172415022 20:34758168-34758190 CTGTATATCCAGAATTACAAAGG - Intronic
1172488161 20:35312307-35312329 CTGGATATCCTGAATTACAAGGG - Intronic
1172858562 20:38028284-38028306 CTCACTATGCAGAATTATAGAGG + Intronic
1172953413 20:38737552-38737574 CTGAAAATACAAAATTAGCAGGG + Intergenic
1174587995 20:51623625-51623647 CTAAATATACAAAATTATCCAGG + Intronic
1174892469 20:54411276-54411298 TTTAATATATAGAAATATAATGG - Intergenic
1175209947 20:57347795-57347817 CTGAATAACCAGGATTATAGAGG + Intergenic
1175577499 20:60072515-60072537 CTGAATATACAGACTAATTCAGG + Exonic
1175893556 20:62326057-62326079 CTGAAAATACACAATTATCAGGG + Intronic
1176943179 21:14948543-14948565 CAGAATTTAGAGAATTAAAATGG + Intergenic
1176978387 21:15351061-15351083 CTGACTACACAGGAATATAAAGG + Intergenic
1176985740 21:15433495-15433517 GCGAATATACAGAATGTTAAGGG - Intergenic
1177248505 21:18562625-18562647 CTGAACATCCAGAATTATGGAGG - Intergenic
1177512928 21:22113619-22113641 CTGATTATACATAATAAAAAGGG + Intergenic
1180838498 22:18945831-18945853 CTGAACATCCAGAATTATGGAGG + Intergenic
1182183811 22:28380312-28380334 AAGAATATACAGGATAATAAGGG + Intronic
1182882970 22:33749273-33749295 CTGAAAATACAAAATTATCCAGG - Intronic
1183921455 22:41172426-41172448 TTGATTATACAGAATAATCATGG - Intronic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184635732 22:45828572-45828594 CTGATTCTACAGAAATAAAAAGG + Intronic
1185283399 22:49986988-49987010 CTGATTTTACAGAAATAAAAAGG - Intergenic
949432250 3:3990305-3990327 CTTATTAAACAGAATTGTAAGGG + Intronic
949650579 3:6154429-6154451 CTGCAGAGACAGCATTATAAAGG + Intergenic
949942285 3:9164156-9164178 CTGAAAATACAGAATTAGCCAGG - Intronic
950030534 3:9849674-9849696 CTGAACATCCAGAATTATGGAGG - Intronic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
951370172 3:21836379-21836401 TTGAATATGCAGAAGTGTAAAGG - Intronic
952034373 3:29181580-29181602 CTGCAGATACAGCATTACAAAGG - Intergenic
953190924 3:40687297-40687319 TTAAATATACAGACTCATAAAGG - Intergenic
954247884 3:49345981-49346003 TTGAAAATACAGAATTATCTGGG + Intergenic
954596269 3:51827862-51827884 CTGAATAATGAGAATTATTATGG - Intronic
954991713 3:54846666-54846688 CTTTATATACAAAATCATAATGG - Intronic
955288550 3:57669031-57669053 CTGAATATACAAAATTAGCTGGG - Intronic
955862387 3:63345392-63345414 CTGACTATGCAAAATTATGACGG - Intronic
956383469 3:68690574-68690596 CTGATTTTACAGAAATAAAAAGG - Intergenic
956611673 3:71130083-71130105 CTGTAGATGCAGAATTACAAAGG + Intronic
956982369 3:74654074-74654096 GTGGAGATACAGAATTTTAATGG + Intergenic
957047808 3:75389999-75390021 CTGAAAATACAAAATTATCTGGG - Intergenic
957222834 3:77406519-77406541 TTGAATATACAGTATTAATAAGG - Intronic
957343512 3:78931405-78931427 CTGAAAATACAAAATTAGACGGG - Intronic
958432024 3:94051260-94051282 CTCAATATACTCAATGATAATGG + Intronic
958600881 3:96295645-96295667 CTAAAAATAGAGAATTATTAAGG - Intergenic
958700439 3:97582188-97582210 CTGAAAATACAAAATTATCCGGG - Intronic
959070635 3:101698997-101699019 CTGAACATCCAGAATTATGGAGG + Intergenic
959206441 3:103312989-103313011 CAGAATCTACAGAAATACAATGG - Intergenic
959430985 3:106255209-106255231 CTGATCCTACAGAAATATAAAGG + Intergenic
960027577 3:113026269-113026291 CTGAACATCCAGAATTATGGAGG - Intergenic
960753817 3:120985735-120985757 CTCATTATACAGAAATAAAAAGG - Intronic
961297446 3:125897744-125897766 CTGAACATCCAGAATTATGGAGG + Intergenic
961317000 3:126045457-126045479 CTGATTCTACAGAAATAAAAAGG + Intronic
961392367 3:126560298-126560320 CTGACCATACAGAAATAAAAAGG - Intergenic
962061841 3:131936262-131936284 GTGAATAAATAGACTTATAAAGG + Intronic
962682155 3:137811402-137811424 TGGAATTTACAGCATTATAAAGG + Intergenic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963959281 3:151290267-151290289 CTCAAGATACAGAATTAAATTGG - Intronic
963971491 3:151435033-151435055 CTCAAGATACAGAATTAACAGGG - Exonic
964192178 3:154016073-154016095 CTAAAAATACAGAATTAGATGGG + Intergenic
964351808 3:155810419-155810441 CTAAAAATACAAAATTATCAGGG + Intergenic
965308920 3:167103809-167103831 ATCAATATACATAATTTTAATGG - Intergenic
965746033 3:171927139-171927161 CTGCATCTACAGAATGAAAAAGG + Intronic
966975548 3:185080296-185080318 CTGATTAGACACAATTTTAATGG - Exonic
967026007 3:185564547-185564569 CTGAACATCCAGAATTATGGAGG - Intergenic
967647377 3:191942637-191942659 CCAAGTATACAGAAATATAAAGG + Intergenic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
970099116 4:12500775-12500797 CTGAATATTTTCAATTATAAAGG + Intergenic
970438631 4:16060166-16060188 CTGAAAATTCAGAAGTACAAAGG - Intronic
970622940 4:17844866-17844888 CTGAATACTCAGAATACTAAAGG - Intronic
970825521 4:20268529-20268551 CAGAATACACACAATGATAAAGG - Intronic
971179953 4:24320569-24320591 TTGAAAATACAGTATTTTAACGG + Intergenic
971580346 4:28330841-28330863 TTGAATACTCAGCATTATAAAGG - Intergenic
971901457 4:32664659-32664681 CTGAAAATACAAAATTAGCAAGG + Intergenic
972537885 4:40014242-40014264 CTGAAAATACAAAATTAGCAAGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972937365 4:44154473-44154495 CTGTAATTACAGATTTATAATGG - Intergenic
973116469 4:46466134-46466156 CTGAAAATACAAAATTATCAGGG - Intronic
973950171 4:56004640-56004662 GTCACTATATAGAATTATAAAGG - Intronic
974601400 4:64085821-64085843 GTGTATAGACAGAATTAAAAGGG - Intergenic
974776664 4:66492164-66492186 CTACATTTACAGTATTATAATGG + Intergenic
975017019 4:69434344-69434366 CTAAAAATACAAAATTATACGGG + Intergenic
975409152 4:74027917-74027939 AAAAATATACAGAATCATAATGG - Intergenic
975602044 4:76111701-76111723 CTAAATATACAGAATTAGCCGGG - Intronic
975848637 4:78549457-78549479 CTGAATACACAGAACTTTACAGG - Intergenic
976196781 4:82539759-82539781 TTAAATATACAGAATAAAAATGG + Intronic
976402158 4:84619869-84619891 CTAAAAATACAGAATTAGACGGG + Intronic
976494148 4:85707215-85707237 CTGAATTTAAAGTACTATAAAGG - Intronic
976927493 4:90517571-90517593 TTGAATATACAGATTTAAACTGG + Intronic
977145475 4:93434509-93434531 CTGAAAAGACAAAATTAAAAAGG - Intronic
980386728 4:132094743-132094765 CAAAATATTCAGAGTTATAATGG - Intergenic
980798259 4:137713440-137713462 CTGAATATAAATATTTATTAAGG + Intergenic
980900630 4:138901857-138901879 CTAAAAATACAGAATTAGATGGG + Intergenic
981213096 4:142131792-142131814 CTGAAAATACAAAATTAGATGGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981651613 4:147065661-147065683 CTTAATATCCATATTTATAATGG - Intergenic
981823213 4:148909977-148909999 CTGAAAATTCATAATTAAAAGGG + Intergenic
982211765 4:153042826-153042848 GTAAAAATACAGTATTATAATGG - Intergenic
982517975 4:156376017-156376039 CTGATAATACAGAAATTTAAAGG + Intergenic
982645587 4:158021395-158021417 CTGAGCATAGAGATTTATAAAGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984505306 4:180610134-180610156 CTGATCAAACAGAACTATAAAGG - Intergenic
985482458 5:123675-123697 CTGATTCTACAGAAATAAAAAGG - Intergenic
986501535 5:8405823-8405845 CTGAATATACAAAATATTCAAGG - Intergenic
986954348 5:13132967-13132989 CTGAAAATACAAAATTATCCGGG - Intergenic
987368847 5:17174802-17174824 CAAAATATTCACAATTATAATGG + Intronic
987582263 5:19809370-19809392 CTTAAGATATAGAATTAGAATGG + Intronic
988092171 5:26557663-26557685 CTAAATATACCCAATTAAAAAGG - Intergenic
988351827 5:30118590-30118612 CTAAAAATACAGAATTAGCAGGG - Intergenic
988380131 5:30488644-30488666 CTGAACATCCAGAATTATGGAGG - Intergenic
988680240 5:33477775-33477797 CTGAAAATACAAAATTAGCAGGG - Intergenic
989472966 5:41842165-41842187 TTGAAAATTCAGTATTATAAAGG + Intronic
989836650 5:46002038-46002060 CTGAATATTCAGAATTGTGGAGG - Intergenic
990333720 5:54751875-54751897 CTAAAAATGCAGAATTATCAAGG - Intergenic
990843648 5:60112172-60112194 TGAAATATACAGAAATATAATGG - Intronic
991571558 5:68059818-68059840 CTGAAAATACAAAATTATCCCGG - Intergenic
992380877 5:76236399-76236421 CTAAAAATACAGAATTATCCAGG + Intronic
992553819 5:77884416-77884438 CTGTATATACAGAGTGAGAAAGG + Intergenic
994572627 5:101533581-101533603 CTGAATGTACAGAATAAGAAAGG - Intergenic
995607957 5:113878660-113878682 CTAAGTCTACAGAAATATAAAGG - Intergenic
996297855 5:121944410-121944432 CAGAATTTAGATAATTATAAAGG - Intergenic
996451316 5:123628909-123628931 CTGATAACACAGAAATATAAAGG + Intergenic
997043715 5:130288434-130288456 ATGATTATAAACAATTATAATGG + Intergenic
997402963 5:133616738-133616760 ATGAATATGCAGTATTATGATGG + Intergenic
998651222 5:144123808-144123830 ATAAATATACAGGATTACAAAGG - Intergenic
998753089 5:145346117-145346139 ATGAATAAACAGAATTTCAAAGG - Intergenic
999951853 5:156659705-156659727 CTGAACATCCAGAATTATGGAGG - Intronic
1000010762 5:157229751-157229773 CTAAAAATACAGAATTATCCGGG + Intronic
1000116770 5:158161032-158161054 CTGAATGTTCAGAATTAAAAAGG - Intergenic
1000570589 5:162908665-162908687 CTGAATAAAGAGAATTCTGATGG + Intergenic
1001167567 5:169384569-169384591 CTAAATGGACAGAATCATAAAGG - Intergenic
1001540960 5:172539029-172539051 AAGGATATACAGAAATATAAGGG - Intergenic
1001871329 5:175158488-175158510 GTGTAAAAACAGAATTATAATGG + Intergenic
1002003294 5:176211395-176211417 CAAAATAAAAAGAATTATAAGGG - Intergenic
1002223159 5:177699546-177699568 CAAAATAAAAAGAATTATAAGGG + Intergenic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1002795525 6:468198-468220 CTGAATAAACAGAAATGTGATGG + Intergenic
1003350289 6:5310820-5310842 CTGAAAATAGAGAAATGTAAGGG + Intronic
1003794360 6:9583467-9583489 CTGAAAATAGAGATTTATAATGG + Intergenic
1003890935 6:10562995-10563017 CTAAATATACAGAATTAGTTGGG + Intronic
1004195272 6:13498741-13498763 CTTAAAATACAGAATTATCCGGG - Intergenic
1004389822 6:15200759-15200781 CTAAATATACAAAATTAGACGGG + Intergenic
1004407037 6:15342622-15342644 CAGAATATACACATTTTTAATGG + Intronic
1004879444 6:19992706-19992728 ATGTATATAAAAAATTATAATGG + Intergenic
1005730328 6:28690943-28690965 CTGAACATCCAGAATTATGGAGG + Intergenic
1006319094 6:33309222-33309244 CTAAAAATACAGAATTATCCGGG + Intronic
1007875207 6:45091408-45091430 CAGAATACTCAGAATTAGAAGGG + Intronic
1008052475 6:46914290-46914312 CTGAAAATACAGATTTATGAAGG - Intronic
1008818581 6:55602293-55602315 ATGAATATCCAAAACTATAAGGG + Intergenic
1009598745 6:65771280-65771302 ATGAATATAATGAATTATAAAGG + Intergenic
1009742632 6:67767125-67767147 CTAAAGATACAGTATTATCAAGG - Intergenic
1009829988 6:68918031-68918053 CAGAATATACAGATTCATAGAGG + Intronic
1010174359 6:73009701-73009723 CTGATTCTACAGAAATAAAAAGG + Intronic
1010338446 6:74718452-74718474 CTGATTCTACAGAAATAAAAAGG - Intergenic
1010591606 6:77718936-77718958 CTGAACATCCAGAATTATGGAGG - Intronic
1010688982 6:78886860-78886882 CTGAATATAAAACATTAAAAAGG - Intronic
1010963164 6:82170551-82170573 CTGATTATACAGTATTGTAAAGG + Exonic
1013815497 6:114092834-114092856 CTGAAAATACAAAATTAGCAGGG - Intronic
1014106961 6:117575981-117576003 CTCAATATCCAGAATAAAAAGGG - Intronic
1014228043 6:118870780-118870802 CTGATAATACAGAAATATGAAGG + Intronic
1014329785 6:120048524-120048546 GTGAATACACAGAATTTTTAGGG - Intergenic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1015710232 6:136131047-136131069 CTGAATATACAGAATGGATATGG - Intronic
1016543192 6:145190063-145190085 CTGGTTATACAGTATTATCAGGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017275298 6:152559936-152559958 CTGATACTACAGAAATATAAGGG + Intronic
1018104609 6:160471336-160471358 CTTAATATAAAGACTTATAAAGG - Intergenic
1018348550 6:162929457-162929479 ATTAATAACCAGAATTATAAGGG - Intronic
1018703849 6:166449479-166449501 CAGAATACAGAGAATTCTAAGGG - Intronic
1019072012 6:169354557-169354579 CTGAAGTTAAAGTATTATAAAGG - Intergenic
1019976280 7:4584425-4584447 CTGAACATCCAGAATTATGGAGG - Intergenic
1019977216 7:4592929-4592951 CTGAACATCCAGAATTATGGAGG - Intergenic
1020087108 7:5316438-5316460 CTGAAAATACAGAATTAGCCAGG - Intronic
1020470888 7:8533192-8533214 CTGAAAATACATAATGATAGTGG - Intronic
1020517630 7:9143016-9143038 CTGAATGAACGTAATTATAATGG - Intergenic
1020713501 7:11638639-11638661 TTGCATGTACAAAATTATAAGGG + Intronic
1020728327 7:11844852-11844874 CTGAATATAGAGTTTTAAAAGGG - Intergenic
1020743089 7:12046888-12046910 GTGAATACACAGAATATTAAGGG - Intergenic
1022666314 7:32414998-32415020 TTGAATATACAGACTTTGAAGGG - Intergenic
1023553265 7:41391579-41391601 TTAAATATACAGAATTATTTTGG - Intergenic
1023620721 7:42069191-42069213 CTGAATATACACTATAATTAGGG + Intronic
1023853869 7:44168604-44168626 CTGAAAATACAGAATTAGCCAGG - Intronic
1025063666 7:55833879-55833901 AGAAATAAACAGAATTATAAGGG + Intronic
1025618734 7:63148175-63148197 AGAAATAAACAGAATTATAAGGG + Intergenic
1026007618 7:66612420-66612442 CTAAATATACAAAATTAGACGGG - Intergenic
1026271746 7:68842778-68842800 CTGAAAATACAAAATTATCCCGG + Intergenic
1026408099 7:70089575-70089597 CTAAATATCCACAATTAAAAAGG - Intronic
1026600184 7:71771238-71771260 CTGAAAATACAAAATTATCCAGG - Intergenic
1026770468 7:73194243-73194265 CTGAAAATACAAAATTATCTGGG + Intergenic
1027011334 7:74747629-74747651 CTGAAAATACAAAATTATCTGGG + Intronic
1027076706 7:75198417-75198439 CTGAAAATACAAAATTATCTGGG - Intergenic
1027475585 7:78627305-78627327 CTGAATATTCAGAAGTATGGTGG - Intronic
1027597325 7:80190039-80190061 CTGAATATACAGAATTATAAAGG - Intronic
1027770108 7:82395980-82396002 CTGAAAAGAGAAAATTATAAAGG - Intronic
1027817371 7:82993142-82993164 TTGAATATATAGAATTATAAAGG - Intronic
1029065735 7:97846516-97846538 CTGTATAACCACAATTATAATGG + Intergenic
1029428342 7:100511970-100511992 CTGAATATACAAAATTAGCTGGG - Intergenic
1029556859 7:101276450-101276472 CTAAATATACAAAATTAGCAGGG - Intergenic
1029801493 7:102952504-102952526 CTGACTTTACAGAAGTAAAAAGG + Intronic
1029940562 7:104476619-104476641 CTGAAAATACAAAATTATGTGGG - Intronic
1030047435 7:105510137-105510159 CTGAAAATACAAAATTAGCAGGG + Intronic
1030497907 7:110322552-110322574 CTAAATATACAGGATTTTTAAGG + Intergenic
1031135294 7:117877447-117877469 CTGAATAAACAGAAATATTCAGG - Intergenic
1031191356 7:118555858-118555880 CTGAATATAATTAATTAAAAGGG + Intergenic
1031628549 7:124019038-124019060 CTGAATATCCTGAAATATAATGG + Intergenic
1031726619 7:125247770-125247792 TTAAATACACAGGATTATAAAGG - Intergenic
1032288129 7:130559173-130559195 CTGAATATACAAAAAAATTAAGG + Intronic
1032814753 7:135461704-135461726 CTGAATAGCCATAATTATAGGGG - Intronic
1033289284 7:140069358-140069380 CTGACTTTACAGAAATAGAAAGG + Intergenic
1034607045 7:152326577-152326599 CTGAATTTAATGAATTTTAATGG - Intronic
1034648235 7:152667619-152667641 CAGAGTATACTGAATTATAAAGG + Intronic
1035045978 7:155965788-155965810 CTGACAATACACAATTATTAAGG + Exonic
1035545256 8:476664-476686 CTGATTTTACAGAAATAAAAAGG - Intergenic
1036291829 8:7499874-7499896 CTGAACATCCAGAATTATGGAGG - Intronic
1036514338 8:9429910-9429932 CTGAGTAGACAGAATTACAGGGG + Intergenic
1037119808 8:15269160-15269182 CTGATACTACAGAAATATAAAGG + Intergenic
1037510778 8:19579675-19579697 CTGAATAAACAGAAAGTTAAAGG + Intronic
1038094658 8:24294431-24294453 GAGAATATACAGAAATAAAAGGG + Intronic
1038543395 8:28407601-28407623 CTAAATATACAAAATTAGCAGGG - Intronic
1038549963 8:28458711-28458733 CTAAAAATACAGAATTAGATGGG - Intronic
1038610616 8:29057273-29057295 ATGAATATATAAAAATATAATGG + Intronic
1039151654 8:34513360-34513382 CTGAAAATACAAAATTCTCAGGG - Intergenic
1039812229 8:41059343-41059365 CTGAAAATACAGAATTAGCCAGG + Intergenic
1040365033 8:46706448-46706470 CTGTATAACCAAAATTATAATGG - Intergenic
1040632112 8:49226375-49226397 ATAAATAAAAAGAATTATAAAGG + Intergenic
1041113334 8:54508260-54508282 CTGAATAAACAGAGTTCTATTGG - Intergenic
1041264603 8:56052051-56052073 CACAATATACAGAACTAGAAAGG - Intergenic
1042073544 8:64963089-64963111 CTGAAAATACAAAATTAGACAGG + Intergenic
1042568979 8:70141996-70142018 CTGACTATACAGACCTAGAATGG + Intronic
1042599794 8:70487740-70487762 CTAAAAATACAGAATTAGCAGGG + Intergenic
1042690261 8:71490430-71490452 CGCAATAAACAGAACTATAAAGG + Intronic
1043258475 8:78165992-78166014 CTGAATCTACAGAAATTAAATGG + Intergenic
1044591752 8:93919364-93919386 CTGAAAATACAGAATTAGCCGGG + Intronic
1045273853 8:100684097-100684119 CTAAAAATACAAAATTATCAGGG + Intergenic
1045803749 8:106132251-106132273 CTGATTATTCACAAGTATAAGGG + Intergenic
1045923636 8:107562745-107562767 CTGTATATTCAGAATAACAAAGG - Intergenic
1047265568 8:123304848-123304870 CTGATGTTACAGAAATATAAAGG - Intergenic
1047282974 8:123461680-123461702 TTGAATATACAAAGTTATCAAGG - Intronic
1047345008 8:124019245-124019267 ATGAATATACATAATCATCAAGG - Intronic
1047841474 8:128758662-128758684 CTGATAACACAGAATTTTAAAGG + Intergenic
1048057808 8:130885345-130885367 ATGAATATATAGATATATAATGG - Intronic
1048644344 8:136402152-136402174 CTGATAATACAGAAATACAAAGG + Intergenic
1048759490 8:137777604-137777626 TTGATTATACAGGATTATACAGG - Intergenic
1048839585 8:138553049-138553071 CTGAATATACAGAACAAAATAGG - Intergenic
1049127895 8:140809049-140809071 ATGAGTATACAGAAATACAATGG + Intronic
1050129260 9:2393168-2393190 TTTAATATACAGAAATATAGAGG - Intergenic
1050470608 9:5985622-5985644 CTGAAAATACAGAATTAGCCGGG + Intronic
1050549660 9:6738313-6738335 CTAAAAATACAAAATTAGAAGGG + Intronic
1050964712 9:11784324-11784346 CTAAATATACAGAATACAAAAGG - Intergenic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051192486 9:14529966-14529988 CTGACTGTACAGAAGTAGAATGG + Intergenic
1051861961 9:21635782-21635804 CAGAATACACAGGATTAAAAAGG - Intergenic
1052477269 9:28975619-28975641 TTCATTATGCAGAATTATAATGG + Intergenic
1052689395 9:31798054-31798076 TTGAATATACAGCATTCTTAAGG + Intergenic
1052691071 9:31817590-31817612 AAGAATATACAGAGTTAGAATGG - Intergenic
1053195114 9:36111553-36111575 CTAAAAATACAAAATTAGAATGG - Intronic
1054358403 9:64087753-64087775 CTGAATATAAAAAATTAGCAGGG - Intergenic
1054896529 9:70319470-70319492 CTCAATATACAGAATTAAGTAGG - Intronic
1055317986 9:75053488-75053510 TTTAATATACAGAATTATATAGG + Intergenic
1056174780 9:84023647-84023669 CTAAAAATACAGAATTAGCAGGG - Intergenic
1056552869 9:87665409-87665431 GTTAACCTACAGAATTATAAGGG - Intronic
1056560737 9:87726879-87726901 CTGAAAATACAAAATTAGACGGG + Intronic
1056995173 9:91450018-91450040 TTGACTATACAGAAATAAAAAGG - Intergenic
1057138017 9:92708159-92708181 CTGATTTTACAGAAGTATTAAGG - Intergenic
1057539375 9:95951623-95951645 CTGATTTTACAGAAATAAAAAGG + Intronic
1057584328 9:96315821-96315843 TTAAATACATAGAATTATAACGG + Intergenic
1058402042 9:104630697-104630719 CTGAATATAAAGAACTGAAATGG - Intergenic
1058476128 9:105335040-105335062 CTGAATATACAAAGTTAAATGGG - Intronic
1058528519 9:105883858-105883880 GTTTATATACAGACTTATAATGG - Intergenic
1058947463 9:109871621-109871643 CTTAATCTACAGAAATATATCGG - Intronic
1059621939 9:116015447-116015469 GTGAACATTCAGAATGATAATGG - Intergenic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1185608344 X:1380053-1380075 CTGAAAATACAAAATTATCCGGG - Intronic
1185841581 X:3396881-3396903 CTGAATTTAAAAAATTACAAAGG - Intergenic
1186119715 X:6347122-6347144 CTGAGTATTCAAAATTTTAAGGG - Intergenic
1186974291 X:14883625-14883647 GTGAATATATAGCAGTATAATGG - Intronic
1187035580 X:15535894-15535916 CTAAATATAAACAATTAAAATGG + Intronic
1187317551 X:18210808-18210830 ATAATTATACAGAAATATAATGG - Intronic
1187572937 X:20523673-20523695 CTGAAAAAGCAGAACTATAAGGG + Intergenic
1187925474 X:24245794-24245816 CTTAATATACACAGCTATAATGG - Intergenic
1188023348 X:25183153-25183175 CTGAAGATATACAATTAAAAGGG - Intergenic
1188145804 X:26611820-26611842 CTGAAAATGCAGGATTACAAGGG + Intergenic
1188181478 X:27061399-27061421 CTGAATATCCAGAATTTACAAGG + Intergenic
1188885314 X:35542643-35542665 CTGATACTACAGAAATATAAAGG - Intergenic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1189681906 X:43525774-43525796 CTAAAAATACAAAATTAGAAGGG + Intergenic
1189984489 X:46542117-46542139 CTACAAATACAGAATTAGAAGGG + Intronic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1191169332 X:57425050-57425072 CTGAAAATAAAAAATTAGAAAGG + Intronic
1192332910 X:70192868-70192890 CTGATGACACAGAAATATAAAGG + Intronic
1193184544 X:78496638-78496660 ATGAATAGACAGGATTAGAAAGG + Intergenic
1193331801 X:80243279-80243301 CTGAAAATACAGAATTATTTGGG - Intergenic
1194104064 X:89746083-89746105 GTGAATAGAAACAATTATAAAGG - Intergenic
1195402764 X:104479329-104479351 ATGAATAAACAGAATTAGATTGG - Intergenic
1195515257 X:105767120-105767142 TTGAGTGTACAGAATTAAAAGGG + Exonic
1195599746 X:106732581-106732603 CTGAGTATACAAAATAATTAAGG + Intronic
1196268366 X:113680137-113680159 CTGAATAAACATGATTGTAAAGG - Intergenic
1196732693 X:118957089-118957111 CTGACTTTACAGAAATAAAATGG + Intergenic
1196822769 X:119715588-119715610 CTGACTTTACAGAAATAAAAAGG + Intergenic
1197620474 X:128742187-128742209 CTGAATATACAGGATCAGGAAGG + Intergenic
1197704053 X:129621177-129621199 TTAAATATACATAATTACAAAGG - Intergenic
1199106832 X:143878120-143878142 CTATATATGTAGAATTATAAAGG + Intergenic
1199931175 X:152524026-152524048 CTGAATAGCCAGAATAATAGGGG + Intergenic
1200226891 X:154422662-154422684 CTGAAAATACAAAATTAGCAGGG + Intergenic
1200326079 X:155240996-155241018 CAGAATACACAGAAATATCAAGG - Intergenic
1200408003 Y:2833458-2833480 CGGAATAACCATAATTATAATGG + Intergenic
1200456018 Y:3393889-3393911 GTGAATAGAAACAATTATAAAGG - Intergenic
1201208095 Y:11651944-11651966 CAGAATAGACACAAATATAATGG + Intergenic
1201217749 Y:11737912-11737934 CGGAATATACACAAATAGAATGG + Intergenic
1201235100 Y:11901639-11901661 CTGAATTTAAAAAATTATAAAGG + Intergenic
1201452831 Y:14134945-14134967 CTCAATATAAAGAGTTAGAAGGG + Intergenic
1202147397 Y:21813862-21813884 CTGACTTTGCAGAATCATAAAGG + Intergenic