ID: 1027604764

View in Genome Browser
Species Human (GRCh38)
Location 7:80287304-80287326
Sequence GTGGAGAGAACAGTGATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027604757_1027604764 26 Left 1027604757 7:80287255-80287277 CCCTGGCAGTGGCTGCATGGCAT No data
Right 1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG No data
1027604756_1027604764 27 Left 1027604756 7:80287254-80287276 CCCCTGGCAGTGGCTGCATGGCA 0: 3
1: 6
2: 34
3: 72
4: 318
Right 1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG No data
1027604758_1027604764 25 Left 1027604758 7:80287256-80287278 CCTGGCAGTGGCTGCATGGCATG No data
Right 1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027604764 Original CRISPR GTGGAGAGAACAGTGATTGT AGG Intergenic
No off target data available for this crispr