ID: 1027611145

View in Genome Browser
Species Human (GRCh38)
Location 7:80362214-80362236
Sequence CTGCATAAACAGCTGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027611145_1027611148 24 Left 1027611145 7:80362214-80362236 CCAAGAGCCAGCTGTTTATGCAG No data
Right 1027611148 7:80362261-80362283 CTTTTTTTTTTTTCAGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027611145 Original CRISPR CTGCATAAACAGCTGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr