ID: 1027613607

View in Genome Browser
Species Human (GRCh38)
Location 7:80393340-80393362
Sequence CCTACTTTGTATAATTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027613607_1027613611 11 Left 1027613607 7:80393340-80393362 CCTTCCTAATTATACAAAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1027613611 7:80393374-80393396 GAGTACATGAAGTGGCAACGTGG 0: 1
1: 0
2: 0
3: 22
4: 81
1027613607_1027613612 12 Left 1027613607 7:80393340-80393362 CCTTCCTAATTATACAAAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1027613612 7:80393375-80393397 AGTACATGAAGTGGCAACGTGGG No data
1027613607_1027613613 13 Left 1027613607 7:80393340-80393362 CCTTCCTAATTATACAAAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1027613613 7:80393376-80393398 GTACATGAAGTGGCAACGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 87
1027613607_1027613610 3 Left 1027613607 7:80393340-80393362 CCTTCCTAATTATACAAAGTAGG 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1027613610 7:80393366-80393388 TGCAGCAAGAGTACATGAAGTGG 0: 1
1: 0
2: 0
3: 18
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027613607 Original CRISPR CCTACTTTGTATAATTAGGA AGG (reversed) Intronic
900883218 1:5397238-5397260 CCTTCCCTGTATAAGTAGGATGG + Intergenic
902740279 1:18433141-18433163 CCCACCTTGTATAATCTGGATGG - Intergenic
904399518 1:30246984-30247006 CCTTCTCTGTAAAACTAGGATGG + Intergenic
905161663 1:36041177-36041199 TATATTTTTTATAATTAGGAAGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907818427 1:57943038-57943060 CCTTTTCTGTATAATAAGGATGG - Intronic
916238246 1:162612405-162612427 CCTGCTTTGAATTATTAGGCTGG + Intergenic
918803552 1:189006917-189006939 CTTACTTTTTATGATTGGGATGG + Intergenic
924061672 1:240181494-240181516 CCTTCTTTGTATGAATTGGAAGG + Intronic
1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG + Intronic
1064877146 10:20007042-20007064 GCTACTTTGTATAATTATTTTGG + Intronic
1065937963 10:30537934-30537956 ACTAATTTGTATTATTAGAAGGG - Intergenic
1066038128 10:31515009-31515031 CCTCCTTTGCACAATTAGCAGGG + Intronic
1066194465 10:33085353-33085375 CCTAATTTTTATCATTAGGTTGG + Intergenic
1068839284 10:61592070-61592092 CCTACTTTCTATAACTTAGATGG - Intergenic
1069847635 10:71383820-71383842 CCTGCATTTTATAATAAGGAAGG + Intergenic
1072618965 10:97067478-97067500 TCTCCTTTGTATAATGGGGATGG - Intronic
1072765619 10:98092641-98092663 CTTACTTTGTATCATTGAGAGGG + Intergenic
1073506149 10:103993767-103993789 CCAAATTTGTATATTTTGGAAGG + Intronic
1076187115 10:128458642-128458664 ACTGCTTTGTATAAATGGGAAGG - Intergenic
1081257876 11:40919803-40919825 CCTAATTTTTATAATTAAAATGG - Intronic
1082226682 11:49715940-49715962 CCTCCTCTATATAATGAGGATGG - Intergenic
1085523269 11:77150403-77150425 TCTTGTTTGTAAAATTAGGAGGG + Intronic
1088217459 11:107528312-107528334 CCTACTTTGTTTTATGAGGCTGG - Intronic
1090884464 11:130863555-130863577 CCTACTCTGTACAATTGGGACGG + Intergenic
1092355636 12:7792658-7792680 CCTTTTTTTTAAAATTAGGATGG - Intronic
1093278140 12:17154318-17154340 TCTTCCTGGTATAATTAGGATGG - Intergenic
1094237815 12:28188756-28188778 CCTACTTTGTAAAATTATTGTGG + Intronic
1097590561 12:61569469-61569491 CTTACTTTATAAAAATAGGAGGG - Intergenic
1098125208 12:67284523-67284545 TTTACTTAGTATAATTAGGGAGG + Intronic
1106767346 13:32926756-32926778 CCTACTTTGGATTATGAGGCGGG + Intergenic
1107602442 13:42027479-42027501 CCAACCTTGGATAGTTAGGAAGG - Intergenic
1108754424 13:53482555-53482577 CCTACTTTCTTTTTTTAGGACGG - Intergenic
1109661903 13:65471156-65471178 TCTAATTTGTAATATTAGGAAGG - Intergenic
1110381858 13:74861530-74861552 CTTACTTTGTATATTTTGTATGG - Intergenic
1116403351 14:44536636-44536658 CCTACTCAGTATAATAAAGATGG + Intergenic
1117760490 14:59022218-59022240 CCTATTTTGAATATTTAGCATGG - Intergenic
1120306949 14:82782855-82782877 CCTCCTCTGTCTGATTAGGAAGG + Intergenic
1125838348 15:42773995-42774017 ACTGCTTTGTATAGTTAGGCAGG - Intronic
1127001970 15:54519494-54519516 CATACTCTCTTTAATTAGGATGG + Intronic
1128704213 15:69826969-69826991 CCTTCTCTGCAAAATTAGGAAGG - Intergenic
1129953290 15:79610872-79610894 CCTTGAGTGTATAATTAGGAAGG - Intergenic
1131255605 15:90859959-90859981 CCAACTTTGTTTAATGAGAAGGG - Intergenic
1137059885 16:35781695-35781717 ACTATTTTGTAGAATTATGACGG - Intergenic
1138134035 16:54506312-54506334 CTTACTTTAAATAATTGGGAAGG - Intergenic
1143223860 17:5283368-5283390 CCAACTTTGATTATTTAGGATGG - Intronic
1144296984 17:13885641-13885663 CTGTCTTTGTATCATTAGGAGGG + Intergenic
1149320629 17:55477466-55477488 CCCCCTTTTTATAATTAGGCAGG + Intergenic
1153803584 18:8692925-8692947 CCTACCTTCTGTAATTAGGGTGG - Intergenic
1156785995 18:40916011-40916033 TCTCCTTTGTATAATTTGCAGGG - Intergenic
1160029642 18:75247681-75247703 CGTATTTGGTATAATTAGAAGGG + Intronic
1160277620 18:77452130-77452152 TCTACTTTCTATAATTTGAAAGG + Intergenic
1167711340 19:51113184-51113206 CCTAATTTGGATAATGATGATGG - Intergenic
927465560 2:23333899-23333921 CATACTTTGATTAATTAGAAAGG + Intergenic
928796209 2:35022923-35022945 CCTACTTAATATAATAAAGAAGG + Intergenic
928953227 2:36833726-36833748 ATTACTTTTTATAATCAGGATGG + Intergenic
943174323 2:184450246-184450268 TCACGTTTGTATAATTAGGATGG - Intergenic
944122415 2:196254375-196254397 CATACTTTGTATATTTATGATGG - Intronic
945647805 2:212522221-212522243 CCTTGTTTGTAAAATAAGGATGG + Intronic
1168740360 20:185026-185048 CCTACTTTGTAGAATGAGTTAGG - Intergenic
1169150973 20:3289098-3289120 GCTACTTTGTAGAATGAGGTGGG + Intronic
1169608925 20:7356841-7356863 ACTGCTTTGTATAATTATAATGG - Intergenic
1171279244 20:23882235-23882257 CCTATCTTTTATCATTAGGAAGG + Intergenic
1174235555 20:49087827-49087849 CCTTCCTTTTAAAATTAGGACGG - Intronic
1182011242 22:27002455-27002477 CCTAGTTTGTAGTATTAGGTCGG + Intergenic
1182509051 22:30806125-30806147 CTTCATTTGTATAATAAGGATGG - Intronic
1182909015 22:33964825-33964847 GCTACTTTGGATAATGAAGATGG - Intergenic
1182942703 22:34293038-34293060 ACTGCTGTGTATAATGAGGACGG + Intergenic
950813050 3:15668423-15668445 CCTACTACTAATAATTAGGAAGG + Exonic
951404039 3:22271947-22271969 CATACTGTGTATCATTAGCATGG - Intronic
953164182 3:40449833-40449855 CCTACTGTCTATGATGAGGAGGG + Intergenic
957545675 3:81633292-81633314 TCTACCTTGTATAATTGTGAAGG - Intronic
960446850 3:117759555-117759577 CTTACATTGTATATCTAGGAAGG - Intergenic
960543445 3:118885670-118885692 ACTACCTTGTATAATGAGTAGGG + Intergenic
963965127 3:151359652-151359674 CCTCCTTTATACAATAAGGATGG + Intronic
970503268 4:16700684-16700706 CCCACTTTGTATATTTACAAGGG - Intronic
970514808 4:16817968-16817990 CCTAAATTTTATAATTAGGTGGG + Intronic
970904662 4:21201930-21201952 CCTACCTTATAAAATTATGATGG - Intronic
976552817 4:86415906-86415928 CCAACTTTGTCTAATCTGGAAGG - Intronic
979723688 4:123934366-123934388 CCTACTGAGGATAATTTGGAAGG + Intergenic
980048123 4:128011544-128011566 CCTACTTAAGATAATTAGAATGG + Intronic
981301641 4:143193455-143193477 GCTACTCTGTATAAGTAGAATGG + Intronic
981572618 4:146168946-146168968 TGTCCTTTGTCTAATTAGGAAGG + Intergenic
982660069 4:158196075-158196097 CCTTCTTAGTATAGTTAGCAAGG + Intergenic
982777797 4:159459687-159459709 CCTACTTTATAATATTAGGTTGG + Intergenic
989068558 5:37487516-37487538 ACAACTTAATATAATTAGGAGGG - Intronic
991920237 5:71649374-71649396 CGTAATTTGTATCATTTGGAGGG + Intronic
992104117 5:73436455-73436477 CCTAATTAGTCTAATTAGAAAGG + Intergenic
992386552 5:76290247-76290269 CCTACTTGGTATAATTTGAAAGG + Intronic
993526810 5:88975270-88975292 CTTAATTTTCATAATTAGGAGGG + Intergenic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
996490445 5:124088449-124088471 TTTACTTTGTAAAAGTAGGAGGG - Intergenic
1000012679 5:157247372-157247394 CCCAGTGTGTATAACTAGGAAGG + Intronic
1003410124 6:5854777-5854799 GCTGTTTTGTATAATTGGGAAGG - Intergenic
1005782876 6:29211560-29211582 TATACTTTGTTTAATTATGATGG + Intergenic
1009709985 6:67305719-67305741 TCTACTTTGGATAACTAGGCTGG + Intergenic
1010668743 6:78660781-78660803 CATAAAGTGTATAATTAGGAAGG + Intergenic
1011155162 6:84322340-84322362 CCTACTTGGTTTGATTTGGAAGG + Intergenic
1011447627 6:87459154-87459176 ACTACTTTGAAAAATTATGAGGG + Intronic
1012082454 6:94778405-94778427 CCTACTTTGAATCTTTAGGTAGG + Intergenic
1012318564 6:97813572-97813594 CCTTATTTGTAAAATTATGATGG - Intergenic
1014610067 6:123532419-123532441 CAGATTTTGTATAATTTGGATGG + Intronic
1015301257 6:131655355-131655377 CATTCTTTGTAAAATGAGGATGG - Intronic
1015680987 6:135808222-135808244 CCCACTCTGTAGATTTAGGAAGG + Intergenic
1020093168 7:5352705-5352727 CCTCCGTTGTATAGTTAGGCTGG - Intronic
1021403066 7:20232272-20232294 CCAATTTTGCATAATCAGGAAGG + Intergenic
1024427723 7:49246785-49246807 ACTACTTTGTATACTTAAAAGGG - Intergenic
1027613607 7:80393340-80393362 CCTACTTTGTATAATTAGGAAGG - Intronic
1033384586 7:140860032-140860054 GCTATTTTGAATAATAAGGAGGG + Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1039504897 8:38044729-38044751 CCTACTGTTTAAAATTAGCAAGG - Intronic
1041185745 8:55299211-55299233 CCTACTTATTAAAATTAGCAGGG - Intronic
1043821064 8:84865164-84865186 AGTACTTTTTATAATTAGGTTGG + Intronic
1045851579 8:106705367-106705389 CATAATTTCTATAACTAGGATGG - Intronic
1050807366 9:9698150-9698172 CTTACTTTGTACACTTCGGAAGG + Intronic
1051180934 9:14411517-14411539 CCTTCTTTGGATGCTTAGGATGG - Intergenic
1056749056 9:89332669-89332691 CCTCCTTTGGATAATTACCAAGG + Intronic
1059219902 9:112605480-112605502 TCTGCTTTGTGTAAGTAGGAAGG - Intronic
1186078982 X:5909956-5909978 CCTTCTTTTTAAAATAAGGAAGG - Intronic
1187165975 X:16804226-16804248 CCGACATAGTATAATTAGGTAGG - Intronic
1193223021 X:78949411-78949433 CCTCTTTTGTAAAATTAGAATGG - Intronic
1193726778 X:85050072-85050094 GCAACTATGTATAATTAGGAAGG - Intronic
1194619729 X:96155724-96155746 AATAGTTTGTATAATTAGGGAGG + Intergenic