ID: 1027630250

View in Genome Browser
Species Human (GRCh38)
Location 7:80595216-80595238
Sequence TGTACACTGCCCAGTACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027630248_1027630250 10 Left 1027630248 7:80595183-80595205 CCACTGTGTGCTACTGAATATGG 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1027630250 7:80595216-80595238 TGTACACTGCCCAGTACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027630250 Original CRISPR TGTACACTGCCCAGTACTAA AGG Intronic
No off target data available for this crispr