ID: 1027632475

View in Genome Browser
Species Human (GRCh38)
Location 7:80623725-80623747
Sequence CCAGGATACATGTTGTTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027632469_1027632475 29 Left 1027632469 7:80623673-80623695 CCAGCTTTCCACAAACTGGAATA 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1027632475 7:80623725-80623747 CCAGGATACATGTTGTTATGTGG No data
1027632470_1027632475 21 Left 1027632470 7:80623681-80623703 CCACAAACTGGAATATTCACTGA 0: 1
1: 0
2: 2
3: 19
4: 323
Right 1027632475 7:80623725-80623747 CCAGGATACATGTTGTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027632475 Original CRISPR CCAGGATACATGTTGTTATG TGG Intronic
No off target data available for this crispr