ID: 1027637148

View in Genome Browser
Species Human (GRCh38)
Location 7:80689691-80689713
Sequence GTCCCAGTCAGGATACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027637148_1027637153 -6 Left 1027637148 7:80689691-80689713 CCTCCATGTATCCTGACTGGGAC No data
Right 1027637153 7:80689708-80689730 TGGGACATGCCTCCCAGCAGGGG No data
1027637148_1027637151 -8 Left 1027637148 7:80689691-80689713 CCTCCATGTATCCTGACTGGGAC No data
Right 1027637151 7:80689706-80689728 ACTGGGACATGCCTCCCAGCAGG No data
1027637148_1027637159 29 Left 1027637148 7:80689691-80689713 CCTCCATGTATCCTGACTGGGAC No data
Right 1027637159 7:80689743-80689765 TCATAAAGGAGAGCTCTGGCTGG 0: 9
1: 479
2: 553
3: 611
4: 541
1027637148_1027637152 -7 Left 1027637148 7:80689691-80689713 CCTCCATGTATCCTGACTGGGAC No data
Right 1027637152 7:80689707-80689729 CTGGGACATGCCTCCCAGCAGGG No data
1027637148_1027637158 25 Left 1027637148 7:80689691-80689713 CCTCCATGTATCCTGACTGGGAC No data
Right 1027637158 7:80689739-80689761 CATCTCATAAAGGAGAGCTCTGG 0: 2
1: 54
2: 562
3: 509
4: 407
1027637148_1027637157 15 Left 1027637148 7:80689691-80689713 CCTCCATGTATCCTGACTGGGAC No data
Right 1027637157 7:80689729-80689751 GGTTGACAGACATCTCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027637148 Original CRISPR GTCCCAGTCAGGATACATGG AGG (reversed) Intergenic
No off target data available for this crispr