ID: 1027638365

View in Genome Browser
Species Human (GRCh38)
Location 7:80703673-80703695
Sequence TGGGTAAGAAGCAGCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027638365_1027638374 28 Left 1027638365 7:80703673-80703695 CCCACCATGCTGCTTCTTACCCA No data
Right 1027638374 7:80703724-80703746 ACCAGCACCCATATAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027638365 Original CRISPR TGGGTAAGAAGCAGCATGGT GGG (reversed) Intergenic
No off target data available for this crispr