ID: 1027642427

View in Genome Browser
Species Human (GRCh38)
Location 7:80753687-80753709
Sequence TTACTGTTGTGGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027642427 Original CRISPR TTACTGTTGTGGATGAAACA TGG (reversed) Intronic
901047577 1:6406810-6406832 TTAATATTGGGGATGAAAGAGGG - Intergenic
901344611 1:8528883-8528905 ATAATTTTGTGCATGAAACAAGG + Intronic
901469700 1:9447835-9447857 TCCCTGCTGTGGATGAAACAAGG + Intergenic
903008329 1:20312963-20312985 TGACTGTTGGGGATCGAACATGG - Exonic
904111941 1:28133099-28133121 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
905578047 1:39061768-39061790 TTACTGTTGGGAATGTAAAATGG + Intergenic
906377645 1:45308838-45308860 TTAAGGTTGTGAATAAAACAAGG + Intergenic
908033459 1:60026854-60026876 TTAATTTTGTGCATGAAACGAGG - Intronic
908319071 1:62963480-62963502 TTATTGTTCTTGATGAACCAGGG - Intergenic
908904576 1:68993319-68993341 CTTGTGTTGTGGATAAAACAGGG + Intergenic
909592620 1:77368422-77368444 ATAATGTTGTACATGAAACAAGG + Intronic
910684304 1:89900834-89900856 GTACAGTTGTGAAGGAAACAGGG - Intronic
910800280 1:91138317-91138339 TTACTTTTGTGGATAGAAGATGG - Intergenic
911216243 1:95198740-95198762 TTTCTGTTGAGGATAAAAGATGG + Intronic
911505256 1:98741190-98741212 CTAGTGTGATGGATGAAACAGGG + Intronic
912046215 1:105461703-105461725 TTTCTGTTGTGAACTAAACATGG - Intergenic
912846687 1:113080741-113080763 TAAATGTTGTGAATGAATCAGGG + Intronic
915386157 1:155494436-155494458 TTACTGTTGTGGATATGTCAAGG + Intronic
915677455 1:157544846-157544868 TGACTGTATTGGAAGAAACAGGG + Exonic
916762005 1:167825476-167825498 TTTTTGTTGTTGTTGAAACAGGG - Intronic
917032252 1:170706434-170706456 TTACTGTTGCTGTTGAAAAAGGG - Intronic
918054997 1:181013325-181013347 TTCCTGTTGTGGTTGAGACAGGG + Intronic
918215424 1:182389373-182389395 TTAGATTTGAGGATGAAACAAGG + Intronic
920144110 1:203843176-203843198 TCACTGTTGTGGATCAAACATGG + Intronic
921705794 1:218322132-218322154 TTAGTGTTGTGGAAAGAACATGG + Intronic
924480691 1:244430628-244430650 TTCCTGTTGTGGATAAAGCAAGG - Intronic
924880204 1:248152656-248152678 TTGCTGTTGTGGGGGCAACAGGG - Intergenic
1063320740 10:5050794-5050816 AAACTGTTGTGTATGATACAGGG - Intronic
1063404944 10:5784814-5784836 TTACTCTGGTGGAGGTAACAGGG + Intronic
1066469557 10:35685127-35685149 TTACTGGAGTGTATTAAACATGG + Intergenic
1067154369 10:43764317-43764339 TTACAGTTGTTGATGAAAAAAGG - Intergenic
1067939175 10:50638496-50638518 TTACTGTTGAGAATGTAAAATGG - Intergenic
1073245277 10:102086054-102086076 TTATTGTTGTTTTTGAAACAGGG - Intergenic
1074476097 10:113775881-113775903 TGACTGTTGTGGATTATAAATGG + Intronic
1075720641 10:124584935-124584957 ATAATTTTGTGCATGAAACAAGG - Intronic
1079700563 11:23541074-23541096 TTAGTGCAGTGGTTGAAACAAGG + Intergenic
1080513086 11:32994728-32994750 TTATTGTTGTTGTTGAGACAGGG + Intergenic
1080622849 11:34001616-34001638 TTTCTGTTGTGGAATAAAAATGG + Intergenic
1081105403 11:39061353-39061375 TTTCTGTTAGGGATGATACATGG - Intergenic
1082094815 11:48121138-48121160 TTACTGTTGTGCATCAACCATGG + Exonic
1085175270 11:74480968-74480990 TTTTTGTTGTTGTTGAAACAGGG - Intergenic
1085496579 11:76975762-76975784 TTACTGTTTTTGAACAAACAAGG - Intronic
1085916461 11:80894355-80894377 TGACTGTTCTGAATGGAACAGGG - Intergenic
1086547064 11:88010029-88010051 ATAATTTTGTGTATGAAACAAGG + Intergenic
1086548456 11:88026756-88026778 TTACTGTGGTGGTTGTAAAATGG - Intergenic
1086775558 11:90828198-90828220 TTGCTAGTGTGAATGAAACAAGG + Intergenic
1087455039 11:98374094-98374116 TTTCTGTTGTGGAAGAAAACTGG - Intergenic
1091896857 12:4112044-4112066 GTAATTTTGTGCATGAAACAGGG - Intergenic
1092589759 12:9941592-9941614 TTTCAGTTGAGGATGAAAAAAGG + Intergenic
1092771507 12:11901141-11901163 TTGTTGTTGTGGTTGAGACAAGG - Intergenic
1093554720 12:20457394-20457416 TTTCACTTATGGATGAAACAAGG + Intronic
1093708261 12:22299273-22299295 TAACTGTTGTATATAAAACAAGG + Intronic
1095522768 12:43086524-43086546 ATACTGTTGTGGTGGAAACATGG + Intergenic
1096913187 12:55004638-55004660 TTAATGTTGATGATGCAACATGG + Intergenic
1097785533 12:63754825-63754847 TGACTGTAGTGGCTTAAACATGG - Intergenic
1098095768 12:66954477-66954499 TTACTGGTGTGGTTGAGACAGGG - Intergenic
1098305633 12:69099882-69099904 TCACAATTGTAGATGAAACAAGG + Intergenic
1098700885 12:73623980-73624002 TTGCTGTTGTGGATGAACTGTGG - Intergenic
1099501950 12:83424183-83424205 GTACTGTAGTGGATTGAACATGG - Intergenic
1099851548 12:88103886-88103908 TCACTGTTCTGGGGGAAACAGGG + Intronic
1100074071 12:90756773-90756795 TTACTTTGTTGGAAGAAACAAGG + Intergenic
1100796735 12:98189783-98189805 TTTTTGTTTTGGATGTAACAAGG - Intergenic
1101171005 12:102093187-102093209 TTAGTGTTCTGTATGAAACAGGG - Intronic
1101356559 12:103983712-103983734 GTACTGTTGTGAAACAAACATGG + Intronic
1102715571 12:114969068-114969090 TGTTTGTTGTGGCTGAAACATGG - Intergenic
1103815926 12:123656199-123656221 TTACTGCTGGGGATGAAGGATGG + Intronic
1107098414 13:36561268-36561290 TTTTTGTTATGGATGACACATGG - Intergenic
1107254770 13:38411398-38411420 TTACTGTTTTTAAAGAAACATGG - Intergenic
1107521641 13:41187867-41187889 TTACCCTTGTGGATTCAACATGG - Intergenic
1109077027 13:57848792-57848814 TTAGTGTTGTGGATATAACAGGG + Intergenic
1109623468 13:64941802-64941824 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1110058645 13:71012332-71012354 ATACGGTTGTGGATAAAACAGGG + Intergenic
1110336289 13:74334551-74334573 TTATGATTGTAGATGAAACATGG - Intergenic
1111959355 13:94793148-94793170 TTCCTGTTGGGGATGCAAAATGG + Intergenic
1112244705 13:97721230-97721252 TGACTGGTGTGGGTGAAACTTGG - Intergenic
1112718982 13:102220584-102220606 TTACTTTTGTGCATTAGACAGGG - Intronic
1112768634 13:102773147-102773169 TTAATGCTGTGGACGTAACAGGG - Intronic
1115125541 14:29988707-29988729 TTTCTGTTGTTCATGAAGCAAGG - Intronic
1115251845 14:31356942-31356964 TAACTACTGTGGATGAAACAGGG - Intronic
1115452792 14:33567248-33567270 TTAATGTTGTGGATGAAAGAAGG - Intronic
1116622001 14:47216945-47216967 ATACTGGAGAGGATGAAACAAGG + Intronic
1117070613 14:52052674-52052696 TCACTGTTGTGGCAAAAACATGG - Intronic
1117485439 14:56192183-56192205 TTACTGTTGTTTTTGAAAAATGG + Intronic
1119081676 14:71700472-71700494 TTACTCTTATGAATGAAACAAGG + Intronic
1119313787 14:73674031-73674053 TTACTGTAATGTGTGAAACATGG + Intronic
1122182862 14:99968520-99968542 TTAATGGTGTGAATGAAAAAGGG + Intergenic
1122224587 14:100266555-100266577 TTACTGTTGGGAAGGTAACATGG + Intronic
1122929463 14:104926719-104926741 TTTCAGTTGTGGTTGAAACAGGG + Intronic
1125026498 15:35035543-35035565 TTATTGGTGTTGATGTAACATGG - Intergenic
1125168511 15:36739217-36739239 TTTTTGTTGTTGTTGAAACAGGG - Intronic
1125582609 15:40797361-40797383 TTTTTGTGGTTGATGAAACAGGG - Intronic
1126325225 15:47469537-47469559 CTACTGATGGGCATGAAACAGGG - Intronic
1126499632 15:49330952-49330974 TTGTTGTTGTTGTTGAAACAGGG - Intronic
1129611157 15:77058638-77058660 GTACTGTTCTAGATGATACAAGG - Intronic
1131006051 15:88979406-88979428 TTATTATTGTTGTTGAAACAGGG - Intergenic
1131007611 15:88991221-88991243 TTAGTGTTGTGGAAAAAACTGGG + Intergenic
1131064176 15:89422778-89422800 TTACAGCTGTGGACCAAACACGG - Intergenic
1132073035 15:98796540-98796562 ATACTTTTGTCGATCAAACAGGG + Intronic
1133354006 16:5122771-5122793 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
1134770120 16:16800984-16801006 TTAAAGTTTAGGATGAAACAGGG + Intergenic
1135247848 16:20872608-20872630 TTACTGATGTGGTTGAAAGCAGG - Intronic
1137908282 16:52349065-52349087 TTACTGGTGGGAATGCAACATGG + Intergenic
1137945994 16:52733793-52733815 TCAGTGTTTTGGATGAAGCAGGG - Intergenic
1138288059 16:55824930-55824952 TTAGAGTTGTGGGAGAAACAAGG - Intronic
1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
1140909655 16:79439703-79439725 TTACTGTGGTCTATGTAACATGG - Intergenic
1143436600 17:6932840-6932862 TTGCTGGTGGGGATGAAAAATGG + Intronic
1143851583 17:9816241-9816263 TTGCTGTTGTCCATGAATCATGG + Intronic
1144351163 17:14398037-14398059 TTCATGTTGTGGATGACTCAGGG + Intergenic
1146960745 17:36974780-36974802 TTTCTTTTGTGAATCAAACAGGG + Intronic
1149142477 17:53450114-53450136 TTACTGTTGTGGATGCTACTAGG - Intergenic
1151012850 17:70521035-70521057 ATACTGTTGTGGATGATATTGGG + Intergenic
1153749905 18:8218681-8218703 CTACTTTTGTGCATGAAGCATGG + Intronic
1155179659 18:23333334-23333356 TAACTGTTGGGGATAAAATAAGG + Intronic
1155752389 18:29441842-29441864 TTTCATTTGTAGATGAAACAAGG + Intergenic
1155781466 18:29841981-29842003 TTGCTGGTGTGGATGAAAAATGG - Intergenic
1156742857 18:40353659-40353681 TTACAGTTGTGTATAAAATAAGG + Intergenic
1158916979 18:62142601-62142623 TTACTGTGGTGGACAAACCAAGG - Intronic
1160617056 18:80138270-80138292 TCACTGTTGTGAATAAAACCCGG - Exonic
1160855113 19:1213769-1213791 CTCCTGATGTGGCTGAAACAAGG - Intronic
1161601002 19:5182746-5182768 TTGCTGGTGGGGATGTAACATGG - Intronic
1167234907 19:48308544-48308566 TTACTGTAATGGCTGCAACAGGG - Intronic
1167791455 19:51685516-51685538 ATATTTTTGTGCATGAAACAAGG + Intergenic
1168484291 19:56747850-56747872 TTACCGTTGTGTGTGAAACTTGG + Intergenic
927679364 2:25129880-25129902 TGTCTTGTGTGGATGAAACACGG + Intronic
927757663 2:25722334-25722356 TTATTGTTGTTGATGAAGCTTGG + Intergenic
928388524 2:30890112-30890134 TTACTGTGGTGGGTGAAATGTGG - Intergenic
929455444 2:42061675-42061697 TCACTTTTGTGGATGATCCAGGG - Intergenic
931621848 2:64218380-64218402 TTATTGTTGTTGTTGAGACAGGG - Intergenic
935631875 2:105218721-105218743 TTACAGTTCTGCATGAACCAGGG + Intergenic
937601697 2:123744281-123744303 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
939441254 2:142253138-142253160 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
939772575 2:146339970-146339992 GCATTGTTGTAGATGAAACAAGG + Intergenic
943080026 2:183248252-183248274 TTAGTGTAGTAGATGGAACAAGG + Intergenic
943600769 2:189918554-189918576 TTACTGGTGGGGATGTAAAATGG + Intronic
944095103 2:195957288-195957310 TTACAGCTGTGGATAAGACATGG - Exonic
946390547 2:219413574-219413596 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
946954998 2:224920077-224920099 TTGCTGTTGTTGTTGAGACAGGG + Intronic
1169063541 20:2679117-2679139 TTACTGCTGTCTATGAAAGAGGG + Intergenic
1170436490 20:16335992-16336014 TTACTGTCCTAGATGAGACATGG - Intronic
1170782975 20:19442308-19442330 TTACTGGTGGGAATGAAAAATGG - Intronic
1172517645 20:35546201-35546223 ATACTGTTGAGGATGAAAATCGG + Intronic
1172852835 20:37978924-37978946 TTGCTGTTGTTGTTGAAACAGGG - Intergenic
1174621262 20:51876383-51876405 TTTCAGTTGGTGATGAAACAAGG + Intergenic
1177221545 21:18200052-18200074 TTGCTGATGGGGATGAAAAATGG - Intronic
1177826572 21:26090931-26090953 TTACTGTTGTGAATACATCATGG + Intronic
1178094227 21:29197113-29197135 TTTCTGTTGTGGAGGAGAGAAGG + Intronic
1178451555 21:32705978-32706000 TTGCTGTTGTTGTTGAGACAGGG - Intronic
1178481700 21:32984916-32984938 TTGCTGATGGGAATGAAACATGG + Intergenic
1182783655 22:32888442-32888464 TTGCTGTTGGGGATGTAACGTGG - Intronic
1183343681 22:37295481-37295503 TCATTGTTGTGGCTGGAACAGGG - Intronic
1185111059 22:48900474-48900496 TTACTCTTCTGGGTGAAACTGGG + Intergenic
949958988 3:9296239-9296261 TTGCTGTTGGGGATGTAAAATGG - Intronic
950826302 3:15825579-15825601 TTTGTGTTGTGTAAGAAACAAGG - Intronic
951215520 3:20021219-20021241 TTACTGGTGTGAATGCAAAATGG + Intergenic
952200148 3:31117771-31117793 TCATTGTTGTTGATGAAACAAGG - Intergenic
953826723 3:46259314-46259336 TAACTGCTGTGGATGAACAATGG + Intronic
955467400 3:59251587-59251609 TTACTGTGCTGGGTGCAACAGGG - Intergenic
955495415 3:59526779-59526801 TTACTGTTGGGAATGTAAAATGG + Intergenic
955934829 3:64092537-64092559 CTAATGTTGTGGATCAGACACGG + Intergenic
956117344 3:65931655-65931677 TTACTGTTGTTGTTGAGACAAGG - Intronic
956420660 3:69083296-69083318 TTATTGTTGTGGATGTATCTGGG - Intergenic
957057906 3:75458463-75458485 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG + Intergenic
959459841 3:106612173-106612195 TTATTGTTTTGGAGGAAAGAAGG - Intergenic
960151602 3:114254317-114254339 GTAGTTTTGTGGATGAAGCAAGG - Intergenic
961025259 3:123550134-123550156 TTGTTGTTGTTGTTGAAACAGGG - Intronic
961993359 3:131215691-131215713 TCACAGTTGTGGATGTAGCAGGG - Intronic
963558638 3:146831399-146831421 TTAGTGTTGTGGATACAACAGGG + Intergenic
964017097 3:151961169-151961191 TTACTGCTGTGGAATAAACTAGG + Intergenic
965718623 3:171635365-171635387 TTACTGTTGGGAATGAAAAATGG - Intronic
967489021 3:190067363-190067385 TTGCTTCTGTGGAAGAAACATGG - Intronic
968883150 4:3311638-3311660 ATAATTTTGTGCATGAAACAAGG - Intronic
970255198 4:14160938-14160960 TTGCTGATGGGAATGAAACATGG - Intergenic
970418412 4:15882013-15882035 CTACAGTTGTTTATGAAACACGG + Intergenic
977260393 4:94790336-94790358 TTACTGTTGTTGTTGTAACATGG + Intronic
981063276 4:140450879-140450901 TTAGTGTAGTAGAAGAAACAAGG - Intronic
981891959 4:149748848-149748870 TTATAATTGTGGATGATACATGG - Intergenic
982167798 4:152630629-152630651 TTAATGTTGTGGACAAAAGAGGG - Intronic
982200253 4:152953500-152953522 TTACTATTTTGGATGCAAAACGG + Exonic
982489702 4:156014526-156014548 CTACTTTTGTGAAAGAAACAAGG + Intergenic
982954400 4:161744564-161744586 TTTCTGTTGGGGATGTGACAAGG + Intronic
983809473 4:172041751-172041773 TAAGTGTGGTGGATGAAAGACGG + Intronic
984588275 4:181587736-181587758 TTACTGATGTAATTGAAACAAGG - Intergenic
984667737 4:182447486-182447508 TTACTGTTGTTGTTGAATCATGG + Intronic
985007269 4:185546253-185546275 TTACTGGTGGGGATGTAAAATGG + Intergenic
985337434 4:188911837-188911859 TTACTGTTGTGGTGGAAATTGGG - Intergenic
986580932 5:9265110-9265132 GGTCTGTTGTGGATGAAATAAGG + Intronic
987574073 5:19703557-19703579 TTTCTTTTGTGGAGGACACAGGG + Intronic
987666299 5:20945519-20945541 TTACTGGTGGGAATGAAAAATGG - Intergenic
988756377 5:34256546-34256568 TTACTGGTGGGAATGAAAAATGG + Intergenic
989704310 5:44310030-44310052 TTACGGCTGAAGATGAAACAAGG - Intronic
993264335 5:85704536-85704558 TAACTGTAGTTGATGAAATATGG + Intergenic
993529003 5:89002696-89002718 CTACTGTTGGGGATGGTACAAGG + Intergenic
996326347 5:122278835-122278857 TTGCTGTTGGGAATGAAAAATGG + Intergenic
996393002 5:122983608-122983630 TTTTTGTTGTTGTTGAAACAGGG + Intronic
996739933 5:126789408-126789430 ATACTTTTGTGTATGAAAGAGGG + Intronic
998959942 5:147474991-147475013 TTACTGGTTGGAATGAAACATGG + Intronic
1000529293 5:162399387-162399409 TTACTGTTGGGAATGTAACTTGG + Intergenic
1001853318 5:174988764-174988786 CAACTGTTGTGTATGAATCAAGG - Intergenic
1003075425 6:2979814-2979836 TTACTATTGTTGATGAAAAGAGG - Intergenic
1003665800 6:8110145-8110167 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1003906372 6:10703602-10703624 ATAATTTTGTGTATGAAACAAGG - Intronic
1004884515 6:20038633-20038655 CCACTGTGGTGGATTAAACAAGG - Intergenic
1006056473 6:31388771-31388793 TGCCTGTTGGGGATGAGACAGGG + Intergenic
1006069199 6:31485750-31485772 TGCCTGTTGGGGATGAGACAAGG + Intergenic
1006240083 6:32670071-32670093 TTGCTGTTTTGCATGAACCATGG - Intergenic
1006275228 6:32999999-33000021 TTACTGTAATGCCTGAAACATGG - Intergenic
1007136872 6:39530978-39531000 AAATTGTTGTGGATGAATCAAGG - Intronic
1007402662 6:41612573-41612595 ATACTGATGTGGTTGAAGCAGGG + Intergenic
1007667215 6:43521913-43521935 TTTCTGTTGTTTTTGAAACAGGG - Intronic
1008904910 6:56666517-56666539 TTGCTGTAGTGGATGAAAAGAGG - Intronic
1009192194 6:60642577-60642599 CTACTGTTGTGGAGAAGACAAGG - Intergenic
1011153519 6:84301833-84301855 TTATTGTTGTTGTTGAGACAGGG - Intergenic
1011282773 6:85693190-85693212 TTCCTATTGTGCATTAAACATGG + Intergenic
1012181752 6:96163244-96163266 TTACTGCTGTCTTTGAAACAAGG - Intronic
1012749971 6:103147579-103147601 TTACTATTGTGTATGCAAGAAGG + Intergenic
1014230438 6:118896241-118896263 TTACTGTTGGGTGTGAAAAATGG - Intronic
1014832484 6:126119354-126119376 TCACTCCTGTGGATGAAACCTGG + Intergenic
1014854711 6:126385462-126385484 TTACTTTGGTTGATGCAACAAGG + Intergenic
1018885400 6:167931183-167931205 TTGCAGTAGTGGATGAAAGAGGG + Intronic
1020051703 7:5086205-5086227 TTACTGCTGTGAAGGGAACAAGG + Intergenic
1021364630 7:19761376-19761398 TTTCTATAGTGGAAGAAACACGG - Intronic
1022284302 7:28940463-28940485 TTCCTGTTTTGGATGTAAGAAGG - Intergenic
1023359966 7:39405894-39405916 TTGCTGTTGTAGCTGATACATGG - Intronic
1023445185 7:40223808-40223830 TTCCTCTTGGCGATGAAACAAGG + Intronic
1024761807 7:52606824-52606846 TCTCTGTTGAGGGTGAAACATGG - Intergenic
1026026456 7:66748451-66748473 TTTCTGTTGTTGGTGAATCACGG + Intronic
1027642427 7:80753687-80753709 TTACTGTTGTGGATGAAACATGG - Intronic
1028022306 7:85792034-85792056 TCACTGCTGGGGATGAAAGAGGG - Intergenic
1031473616 7:122196506-122196528 TTACTTTTGTGAATTAAAAAAGG - Intergenic
1033899474 7:146117143-146117165 TTTCTGTTTTGGAAGAGACAGGG + Intronic
1033982538 7:147183840-147183862 CTCCTATTGTGGCTGAAACATGG + Intronic
1034608162 7:152337262-152337284 TTATTGTTGTTGTTGAGACAGGG - Intronic
1035345446 7:158194078-158194100 TTTTTGTTGTTGTTGAAACAGGG - Intronic
1036173032 8:6508558-6508580 TTACTGTTGTGGTTGCTACTTGG + Intronic
1037128947 8:15384623-15384645 GTACTTTTGGGGATGAACCAGGG - Intergenic
1037174805 8:15934177-15934199 TAACTGTTGTGAATGAAATGGGG - Intergenic
1039805697 8:40995726-40995748 TAACTTTTGTGTAAGAAACACGG - Intergenic
1040673748 8:49724190-49724212 TTGCTGTTGTGAATGCAAAATGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042155183 8:65837550-65837572 ATAATTTTGTGCATGAAACAAGG + Intronic
1042716060 8:71773823-71773845 TTTCTCTTGTGTATGATACATGG - Intergenic
1043248058 8:78031307-78031329 TTATTGTTGTTGTTGAGACAGGG - Intergenic
1043386636 8:79755484-79755506 TTTTTGTTATGGATGAAACATGG - Intergenic
1043937047 8:86154634-86154656 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1046241063 8:111493869-111493891 TTGCTGTTGTGTGTGAAACATGG - Intergenic
1046390400 8:113564907-113564929 TTACTGAAGTTGATGAAACTTGG - Intergenic
1047195829 8:122720695-122720717 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1047467134 8:125127903-125127925 GTAATTTTGTGCATGAAACAAGG + Intronic
1048726403 8:137390319-137390341 TTGCTGTTGTTGTTGAGACAGGG + Intergenic
1049858552 8:144880928-144880950 GTCCTGTTTTGTATGAAACAAGG - Exonic
1050416466 9:5422596-5422618 TTACAGTTGTGTTTGAAATAGGG - Intronic
1050425546 9:5509171-5509193 TTGCTTTTGTAGAAGAAACAAGG + Intergenic
1051497659 9:17742852-17742874 TTAGTTTTTTGGATGATACAGGG + Intronic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052548330 9:29910339-29910361 TTAGTGTAGTGGAATAAACATGG - Intergenic
1056921999 9:90799625-90799647 TTGCTGTTGTGAATGCAAGATGG - Intergenic
1058163956 9:101599599-101599621 TAACTGTTTTGGAAGAAACCAGG + Intronic
1058777351 9:108297391-108297413 TCACTGTTCTGGAAGAAACTGGG + Intergenic
1061527761 9:131181427-131181449 TTGCTGTTGGGAATGAAAAATGG - Intronic
1187284576 X:17892494-17892516 CTACTGGTGGGGATGAAAAATGG + Intergenic
1187759547 X:22565458-22565480 TTATTGGTGTCAATGAAACATGG - Intergenic
1187858750 X:23661921-23661943 TTGCTGGTGTGAATGAAAAATGG + Intergenic
1189432874 X:40964605-40964627 TTAATGTAGTGGATTAAAGATGG - Intergenic
1192047609 X:67692743-67692765 CTTCTTTTGTGGATGAAAAATGG + Intronic
1192120022 X:68446779-68446801 TTGCTGTTGTTGTTGAGACAGGG + Intergenic
1194313665 X:92346204-92346226 TTTTTGTTGTGGAAGAAAGAGGG + Intronic
1196554044 X:117065738-117065760 TTCTTGTTTTGTATGAAACAAGG - Intergenic
1196652963 X:118187565-118187587 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
1197099784 X:122638483-122638505 CTACTGTTGTAAATGAAAAATGG + Intergenic
1198791090 X:140347105-140347127 TTACTGATGTGAAGGAAAAATGG - Intergenic
1199473935 X:148225503-148225525 TTATGCTTGTGAATGAAACAAGG + Intergenic
1199789076 X:151133464-151133486 ATAATCTTGTGCATGAAACAAGG - Intergenic
1200550088 Y:4568730-4568752 TCACTGTTCTGTATGTAACAAGG + Intergenic
1200823319 Y:7612076-7612098 TTAGTGTTGTGGATACAATAAGG - Intergenic
1202236736 Y:22719019-22719041 TTAGTGTTGTGGATACAATAAGG + Intergenic
1202306431 Y:23477149-23477171 TTAGTGTTGTGGATACAATAAGG - Intergenic
1202564378 Y:26193440-26193462 TTAGTGTTGTGGATACAATAAGG + Intergenic