ID: 1027643131

View in Genome Browser
Species Human (GRCh38)
Location 7:80762645-80762667
Sequence CTAATTTTGTAGTAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19999
Summary {0: 3, 1: 30, 2: 212, 3: 2183, 4: 17571}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027643131_1027643138 27 Left 1027643131 7:80762645-80762667 CCCTGTCTCTACTACAAAATTAG 0: 3
1: 30
2: 212
3: 2183
4: 17571
Right 1027643138 7:80762695-80762717 CCCAGCTACTCAGAAGGATAAGG No data
1027643131_1027643134 -10 Left 1027643131 7:80762645-80762667 CCCTGTCTCTACTACAAAATTAG 0: 3
1: 30
2: 212
3: 2183
4: 17571
Right 1027643134 7:80762658-80762680 ACAAAATTAGCTGAGTATGGTGG 0: 12
1: 550
2: 9365
3: 47759
4: 139363
1027643131_1027643136 21 Left 1027643131 7:80762645-80762667 CCCTGTCTCTACTACAAAATTAG 0: 3
1: 30
2: 212
3: 2183
4: 17571
Right 1027643136 7:80762689-80762711 TGTAATCCCAGCTACTCAGAAGG 0: 2095
1: 60229
2: 148427
3: 232830
4: 199842

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027643131 Original CRISPR CTAATTTTGTAGTAGAGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr