ID: 1027644398

View in Genome Browser
Species Human (GRCh38)
Location 7:80779048-80779070
Sequence TGTTATAGAGAGCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027644398 Original CRISPR TGTTATAGAGAGCACTGTGC TGG (reversed) Intronic
900713629 1:4130289-4130311 TCTGATGGAGAGCTCTGTGCAGG - Intergenic
902241217 1:15090633-15090655 GGTTGCAGAGAGCTCTGTGCAGG - Intronic
902915426 1:19635958-19635980 TGTAATAGCTTGCACTGTGCTGG + Intronic
904086153 1:27909840-27909862 TGTTATTGAGTGCTTTGTGCTGG - Intronic
904273296 1:29364322-29364344 TGAGATAGAGAGTCCTGTGCTGG + Intergenic
905831072 1:41068110-41068132 TTTTATGGAGAGCATTTTGCAGG + Intronic
907893091 1:58654625-58654647 TGTTATATAGAACACTGTAGGGG - Intergenic
908122826 1:61001960-61001982 TGTTAAAGAGAACAGAGTGCAGG + Intronic
914788107 1:150851560-150851582 TGTTTCAGAGAGCACTGGGTTGG - Intronic
916799930 1:168207459-168207481 TGTTTCAGAGAGCACTGGGTTGG + Intergenic
917485196 1:175449134-175449156 AGTTGTAGGGAGCACTGTGTGGG + Intronic
918540890 1:185631738-185631760 TGTTATAGAAACTACTGAGCTGG - Intergenic
920796288 1:209140438-209140460 TGTTATATATGGCATTGTGCTGG - Intergenic
920928425 1:210364764-210364786 TGTTGTGGAGAGCACTGAGAAGG - Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923400856 1:233614503-233614525 TGTGGTGGAGAGCACGGTGCTGG - Exonic
923535205 1:234844163-234844185 TGTTATATAGAGCTTTGTACTGG - Intergenic
1065042813 10:21714874-21714896 TTTTATAAAGAGGACAGTGCAGG + Intronic
1065532050 10:26680835-26680857 TGTTATAGATAACACAGTGACGG - Intergenic
1066818607 10:39455329-39455351 TGTTTCAGAGAGCACTGGGTTGG + Intergenic
1067325388 10:45260698-45260720 TGTTTCAGAGAGCACAGGGCTGG - Intergenic
1069063480 10:63918381-63918403 TGTATTTGAGTGCACTGTGCTGG + Intergenic
1069244290 10:66182987-66183009 TGTGATAGTGAACACTCTGCTGG - Intronic
1071417313 10:85453355-85453377 TGTTATAGTTGGCACTATGCTGG - Intergenic
1074542803 10:114379362-114379384 TGTTTTAGACATCACTGTGGGGG - Intronic
1075561991 10:123474733-123474755 AGGTATACAGAGCACAGTGCAGG - Intergenic
1076773045 10:132677503-132677525 TGTGACAGAGAGCCCAGTGCTGG + Intronic
1077830026 11:5857339-5857361 TGCTATGGAGAGCATTGTGTTGG - Exonic
1077889348 11:6407518-6407540 TTTTTTAAAAAGCACTGTGCAGG - Intronic
1078122535 11:8524018-8524040 TGTTTCAGAGAGCACTGGGTTGG - Intronic
1079165194 11:18034341-18034363 TGTTAGAAAGAGCAATATGCTGG - Intronic
1079345604 11:19649360-19649382 TATTATAAAGAACACTGTCCTGG + Intronic
1081028617 11:38048359-38048381 TTTTATAGAAAACACTGTGCTGG + Intergenic
1081139647 11:39483040-39483062 TGTAAGACTGAGCACTGTGCTGG - Intergenic
1083680564 11:64349807-64349829 TGTTGGAGAGAGCACTGTGCTGG + Intronic
1084439352 11:69162968-69162990 TGTTATGGACAGTGCTGTGCTGG + Intergenic
1086434783 11:86770471-86770493 TGTTTCAGAGAGCACTGGGTTGG + Intergenic
1087902905 11:103662799-103662821 TGATAGAAAGAGCACTGGGCTGG + Intergenic
1088116136 11:106316973-106316995 TGTTTCAGAGAGCACAGGGCTGG + Intergenic
1090227287 11:125079346-125079368 TGTAATAGAGAGCACTGGACAGG - Intronic
1090522609 11:127495384-127495406 GGATATAGGGAGCACTGTGATGG + Intergenic
1091356289 11:134940465-134940487 TGTTCAAAAGAGCACTATGCAGG + Intergenic
1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG + Exonic
1095970456 12:47898161-47898183 TCTCAGAGAGAGCTCTGTGCTGG - Intronic
1096856442 12:54487773-54487795 TGTTTCAGAGAGCACGGTGTTGG + Intergenic
1099876462 12:88412823-88412845 TGTTCTAATGAGCACTGTGGAGG - Intergenic
1102008813 12:109605806-109605828 GGTTGAGGAGAGCACTGTGCAGG + Intergenic
1102343687 12:112144023-112144045 TGTTAAAGAGGGAACTATGCTGG - Intronic
1103295662 12:119884596-119884618 AGTTATAGACAGCCGTGTGCCGG + Intergenic
1103301737 12:119932863-119932885 TGTTACAGAGAGCAGTGGGTGGG - Intergenic
1103320550 12:120090495-120090517 TTTTCCAAAGAGCACTGTGCTGG + Intronic
1104523407 12:129496347-129496369 GGTTTTAGAGAGCAATGGGCAGG + Intronic
1105230268 13:18488211-18488233 TGTGTTACAGAGCACTGTGCTGG + Intergenic
1106499659 13:30315732-30315754 TTATACATAGAGCACTGTGCTGG + Intergenic
1109345207 13:61107815-61107837 TGATATAAAGAGCTATGTGCTGG - Intergenic
1110339956 13:74378134-74378156 TGTTGTAAAAAGCACTGTACTGG + Intergenic
1114014515 14:18415026-18415048 TGTGTTACAGAGCACTGTGCTGG + Intergenic
1116741936 14:48766684-48766706 TGCTATAGAGAACAATGTGGAGG + Intergenic
1116900246 14:50355717-50355739 TGTTATAGAGGCCAGGGTGCTGG + Intronic
1118428326 14:65691893-65691915 TGTTTCAGAGAGCACTGGGTTGG + Intronic
1119693986 14:76698207-76698229 TGATATACAGAGCACTGCGCAGG - Intergenic
1119926501 14:78499424-78499446 TGTTATAGTGAGCAGTGGGAAGG - Intronic
1121142643 14:91556825-91556847 TGTTTTAGAGAGCACAGGGTTGG + Intergenic
1121743835 14:96272453-96272475 TTTTCTAGGGAGCACTGTGTTGG - Intergenic
1124132470 15:27003514-27003536 TGTTTCAGAGAGCACAGGGCTGG + Intronic
1124964235 15:34421381-34421403 TTTTATACAGAGCAGAGTGCTGG - Intronic
1124980849 15:34567609-34567631 TTTTATACAGAGCAGAGTGCTGG - Intronic
1125753529 15:42046675-42046697 TGGGAGAGAGAGCACTGAGCAGG - Intronic
1126424465 15:48511852-48511874 GGTTATTGAGAGCACTCAGCTGG - Intronic
1135788751 16:25374409-25374431 TGTGGTAGAGAGCAATGTGTGGG + Intergenic
1136733812 16:32444308-32444330 TGTTATAAACAGCCATGTGCAGG + Intergenic
1136930407 16:34412869-34412891 TGTTTCAGAGAGCACTGGGTTGG + Intergenic
1136974167 16:34998939-34998961 TGTTTCAGAGAGCACTGGGTTGG - Intergenic
1137012880 16:35341062-35341084 TCTGTTATAGAGCACTGTGCTGG - Intergenic
1137493682 16:48952447-48952469 TGTTTCAGAGAGCACAGGGCTGG - Intergenic
1139189878 16:64849912-64849934 TGTTATAAACATCAGTGTGCAGG - Intergenic
1203019270 16_KI270728v1_random:385293-385315 TGTTATAAACAGCCATGTGCAGG - Intergenic
1203037605 16_KI270728v1_random:658451-658473 TGTTATAAACAGCCATGTGCAGG - Intergenic
1144796177 17:17892659-17892681 TGTTGTAGAGACCACTATGTGGG - Intronic
1145896280 17:28459464-28459486 TGTTTTAGAGAGCACAGGGTTGG - Intronic
1145920022 17:28603745-28603767 TGTTTTAGAGAGCACAGGGTTGG + Intronic
1147231783 17:39024826-39024848 TGGAATAGAGACCACTGGGCTGG - Intergenic
1148277339 17:46316905-46316927 TGTTTCAGAGAGCACTGGGTTGG + Intronic
1148299454 17:46534489-46534511 TGTTTCAGAGAGCACTGGGTTGG + Intronic
1150403059 17:64874798-64874820 TGTTTCAGAGAGCACTGGGTTGG - Intronic
1150715009 17:67564649-67564671 TGTTATAAAGAACACTATGATGG - Intronic
1152129262 17:78466133-78466155 TGTTTCAGAGAGCACAGGGCTGG - Intronic
1153235558 18:2983339-2983361 TGTTATATACAGTACTGAGCAGG - Intronic
1153422126 18:4918092-4918114 TGTTACAGAGAGCACGGGGTTGG + Intergenic
1154498349 18:14978831-14978853 TGTTCAAAAGAGCACTGTGCAGG - Intergenic
1155521038 18:26669353-26669375 TATTACAGAGAGCACTGATCTGG - Intergenic
1156198825 18:34807257-34807279 TGTTAGAAAGGGCACTGTCCTGG + Intronic
1157247172 18:46064846-46064868 TATTATAGAAAACACTGGGCCGG + Intronic
1157824142 18:50797373-50797395 TGTGATAAATGGCACTGTGCCGG - Intronic
1158008477 18:52700955-52700977 TGTTATAAAGAGCTTTGTACAGG - Intronic
1160957806 19:1701682-1701704 TGGTGGAAAGAGCACTGTGCGGG + Intergenic
1162056807 19:8069389-8069411 TGTTTTAGGGAGCACTGTGTTGG + Intronic
1163869763 19:19810427-19810449 TATGATACAGAGCACTATGCTGG + Intronic
1163874219 19:19852964-19852986 CATGATAGAAAGCACTGTGCTGG + Intergenic
1163876706 19:19875894-19875916 TATGATACAGAGCACTGTGCTGG - Intronic
1163880158 19:19912837-19912859 TATGATACAGAGCACGGTGCTGG - Intronic
1163882668 19:19940457-19940479 TATGATACAGAGCACTGTGCTGG + Intergenic
1163910110 19:20181920-20181942 AATGATACAGAGCACTGTGCTGG - Intronic
1163912519 19:20209633-20209655 TAAGATACAGAGCACTGTGCTGG + Intergenic
1163913508 19:20217441-20217463 TGTGATACAGAGAACTCTGCTGG - Intergenic
1163921313 19:20292314-20292336 TGTGATACAGAGCACTGTGCTGG - Intergenic
1163924517 19:20327114-20327136 TATGATACAGAGCACTGTGTTGG - Intergenic
1163930562 19:20386801-20386823 TATGATATGGAGCACTGTGCTGG - Intergenic
1163932736 19:20412981-20413003 TATGATACAGAGCACTATGCTGG + Intergenic
1163947868 19:20556846-20556868 TATGATACAGAGCACTGTGCTGG + Intronic
1163956786 19:20650091-20650113 TATGATACAGAGCACTGTGCTGG + Intronic
1163970554 19:20789808-20789830 CATGATACAGAGCACTGTGCTGG - Intronic
1163975548 19:20848267-20848289 TAGGATACAGAGCACTGTGCTGG + Intronic
1163994468 19:21030420-21030442 TATGTTACAGAGCACTGTGCTGG - Intronic
1164021733 19:21313307-21313329 TATGTTACAGAGCACTGTGCTGG + Intronic
1164044637 19:21525972-21525994 TATGTTACAGAGCACTGTGCTGG - Intronic
1164068908 19:21747823-21747845 TACAATATAGAGCACTGTGCTGG + Intronic
1164140918 19:22461954-22461976 TATGTTACAGAGCACTGTGCTGG - Intronic
1164659158 19:29948634-29948656 TGTTTCAGAGAGCACGGGGCTGG + Intronic
1165468624 19:35990062-35990084 TGTCACAGAGACCACGGTGCTGG - Intergenic
925264988 2:2560727-2560749 TCTTAAGGAGAGCACTGAGCAGG - Intergenic
926252667 2:11164829-11164851 TGTTTCAGAGAGCACTGGGTTGG + Intronic
927721317 2:25384461-25384483 TGTGATGGAGAGCAGGGTGCTGG + Intronic
928450874 2:31377675-31377697 GGTTAGAGAGGGCACTGTGGAGG - Intronic
928963625 2:36955181-36955203 TGGTATAGAGAGCAATGCCCTGG + Intronic
930228539 2:48819869-48819891 TGGTATAGAGGGCACTGGGCTGG + Intergenic
931236219 2:60414446-60414468 TGTTCTACACATCACTGTGCTGG - Intergenic
932903499 2:75725491-75725513 TGTTTTAGAGAGCACAGGGTTGG - Intergenic
933153972 2:78950623-78950645 TCTCATAGATAGCACAGTGCTGG - Intergenic
935390052 2:102541542-102541564 TCTTATAGAGAACACTGGACAGG - Intergenic
938522434 2:132084502-132084524 TGTGTTACAGAGCACTGTGCTGG - Intergenic
938720808 2:134064672-134064694 TGTTTCAGAGAGCACAGGGCTGG - Intergenic
940286144 2:152034736-152034758 TGTTTAAAAGAGCACTGTGGGGG - Intronic
940635692 2:156294015-156294037 TGTTTCAGAGAGCACAGGGCTGG - Intergenic
940918012 2:159279122-159279144 TGTTATGGATAGCACTGGTCTGG + Intronic
942112855 2:172700049-172700071 TGTTTCAGAGAGCACGGGGCTGG + Intergenic
943732810 2:191320970-191320992 TGCCCTAGAAAGCACTGTGCTGG - Intronic
946167876 2:217876401-217876423 TGTTAGCCAGAGCACTGAGCCGG + Intronic
947798183 2:232906884-232906906 TGTTTCAGAGAGCACTGGGTTGG - Intronic
948527013 2:238577106-238577128 GGTCATAGAGAAGACTGTGCTGG - Intergenic
1169209660 20:3759033-3759055 TGTGAAGGAGAGCACTGGGCAGG - Intronic
1169970375 20:11263532-11263554 TGTTATAGAGGGCAAGCTGCAGG - Intergenic
1170411460 20:16096577-16096599 TGTGGTAGACAGCACAGTGCTGG - Intergenic
1171177176 20:23061302-23061324 TGTCACAGAGAGCAGGGTGCTGG + Intergenic
1172092419 20:32443363-32443385 TTTTATAGAGAGCATTGAGGAGG + Exonic
1172280121 20:33702020-33702042 TGTTCCAGAGAGCACAGGGCTGG - Intergenic
1172361351 20:34314811-34314833 AGGTAGAGAGAGAACTGTGCAGG + Intergenic
1172689576 20:36781196-36781218 TCTTAAAAAGAGCACTGAGCAGG - Exonic
1172923765 20:38511624-38511646 TGTTTTAGAGAGCACGGGGTTGG + Intronic
1175501193 20:59452465-59452487 TGCTTCAGAGAGCACTGGGCAGG + Intergenic
1175629621 20:60524289-60524311 TCTCATAGAGAGCTCTGTGGAGG - Intergenic
1176774251 21:13116556-13116578 TGTGTTACAGAGCACTGTGCTGG + Intergenic
1177233863 21:18360481-18360503 TGCTATGGAGAACAGTGTGCAGG - Intronic
1178064645 21:28890779-28890801 TGTTATAAATATCAGTGTGCAGG - Intergenic
1180439014 22:15345833-15345855 TGTGTTACAGAGCACTGTGCTGG + Intergenic
1180521879 22:16216276-16216298 TGTGTTACAGAGCACTGTGCTGG + Intergenic
1181594797 22:23907217-23907239 TGTTTCAGAGAGCACGGGGCTGG - Intergenic
1183742565 22:39677137-39677159 TGTTATTCTGAGCCCTGTGCTGG + Intronic
1185114250 22:48922395-48922417 TGTTATGGAGAACACTGGGCAGG - Intergenic
1203240688 22_KI270733v1_random:15012-15034 TCTTGTAGAGAGCACATTGCTGG - Intergenic
949551067 3:5113503-5113525 TGTTTTAGAGAGCACAGGGTTGG + Intergenic
949648697 3:6129412-6129434 TGTTTTAGAGAGCACAGGGTTGG + Intergenic
953804036 3:46052439-46052461 TGTTATAGGGAGGACAGTCCTGG + Intergenic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
955626900 3:60928010-60928032 TGTTTCAGAGAGCACTGGGTTGG - Intronic
955674258 3:61434085-61434107 TGTTTCAGAGAGCACAGGGCTGG + Intergenic
957836681 3:85602830-85602852 TGTAAGAGAGAGCACTGTCAAGG - Intronic
958957144 3:100477200-100477222 TGTTTTAGAGAGCACAGGGTTGG + Intergenic
964580465 3:158229591-158229613 TGTGATTGAAAGCACTGTGTGGG + Intronic
965887560 3:173466314-173466336 TGTTATATACAGTGCTGTGCTGG + Intronic
966485210 3:180461207-180461229 AGTTGTAAAGAGCAATGTGCTGG + Intergenic
967905445 3:194495793-194495815 TATTATACACAGCAGTGTGCTGG - Intronic
968226237 3:196974030-196974052 TGTTTCAGAGAGCACAGGGCTGG - Intergenic
970485965 4:16525157-16525179 TGTTAAAGACAGCTGTGTGCTGG + Intronic
972830817 4:42811827-42811849 TCCTTTAGAGAGCACTGTTCTGG + Intergenic
973784853 4:54325085-54325107 TGTTTCAGAGAGCACAGGGCTGG + Intergenic
975507884 4:75159516-75159538 TATTATAGATACCATTGTGCTGG + Intergenic
980640112 4:135566132-135566154 TTTTGTAGAGAACACTGTGGTGG + Intergenic
981802774 4:148677510-148677532 TGCTCCAGAGAGCAATGTGCTGG - Intergenic
981932654 4:150207876-150207898 TGGTATAGAGACCACTGTAGTGG + Intronic
982022021 4:151214159-151214181 TGTTTCAGAGAGCACAGGGCTGG + Intronic
982541259 4:156674664-156674686 GGTTATATAGAGCACTGGGAAGG - Intergenic
983604746 4:169570881-169570903 TGTTTCAGAGAGCACTGGGTTGG - Intronic
984075458 4:175172575-175172597 TGTTATGGTGAACATTGTGCAGG - Intergenic
984260602 4:177440342-177440364 TGTGAGAGAGAGCAGTGTGACGG - Exonic
986517043 5:8574923-8574945 TGTTAAAAAGAGCATGGTGCTGG - Intergenic
986578191 5:9234454-9234476 TGGTCTAGACAGCACTGGGCTGG - Intronic
988983015 5:36590362-36590384 TTTTATAGAGACCACTATTCCGG + Intergenic
989655688 5:43745466-43745488 TGTTTCAGAGAGCACTGGGTTGG + Intergenic
990424115 5:55668198-55668220 AGTTATAGAGAGAACTCTGTGGG + Intronic
991007353 5:61842745-61842767 GGTTGTAGAGGGCACTGTGGTGG + Intergenic
991444675 5:66686279-66686301 TGTTAAACAGATTACTGTGCTGG - Intronic
991937726 5:71818374-71818396 TGTTATAGAGAGGACATTGGAGG - Intergenic
992822838 5:80515416-80515438 TGATATAGAGAACACTGGACTGG - Intronic
993260570 5:85653867-85653889 TATTATAAAGAGTACTTTGCAGG - Intergenic
994208420 5:97061407-97061429 TCTTTTTGAAAGCACTGTGCAGG + Intergenic
997521356 5:134526224-134526246 TGTTTTAAAGAGTACAGTGCGGG + Exonic
997930981 5:138071047-138071069 TGTTTTAGAGAGCACAGGGTTGG - Intergenic
999532502 5:152479534-152479556 TGTTTCAGAGAGCACTGGGTTGG + Intergenic
1000231153 5:159316493-159316515 TGTTATGTAGGACACTGTGCTGG - Intronic
1000728169 5:164798544-164798566 TGTTAAAGAGCACAATGTGCCGG - Intergenic
1001896662 5:175388499-175388521 TATTATGGAGAGAGCTGTGCTGG + Intergenic
1004068663 6:12276316-12276338 TGTTAGTGCAAGCACTGTGCTGG + Intergenic
1004303345 6:14478005-14478027 TGATGTAGCAAGCACTGTGCTGG - Intergenic
1004307618 6:14515241-14515263 TTTCATAAAGCGCACTGTGCTGG - Intergenic
1006250445 6:32778880-32778902 TGTTTCAGAGAGCACGGTGTTGG + Intergenic
1009463473 6:63942236-63942258 TGTTATAGAGAAAGCTGTGAAGG + Intronic
1013148675 6:107422520-107422542 TATTATAGATAGTACTGTGATGG - Intronic
1013862822 6:114657512-114657534 TGGTATAAAGAGCAATGTGGAGG + Intergenic
1014036353 6:116770660-116770682 TGTTTTAGAAAGCTCTCTGCAGG - Intergenic
1015871410 6:137779961-137779983 AGGTATAGAGACCACTGTACTGG - Intergenic
1019400996 7:853749-853771 AGTTGTTGAGAGCAGTGTGCCGG + Intronic
1019915661 7:4130600-4130622 GGTTATAGAAAGCCCCGTGCTGG + Intronic
1020157364 7:5737224-5737246 TGTTTCAGAGAGCACTGGGTTGG - Intronic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1028434303 7:90783849-90783871 TGCTATAGAGAATACTGTGGAGG + Intronic
1028752716 7:94399384-94399406 TGTTAAAAAGAGGACTGTGGTGG - Intronic
1030565592 7:111151016-111151038 TGTTCTAGAGAATACTGTCCTGG + Intronic
1033038215 7:137894741-137894763 TGTTTTAGAGGGCCCTGTGCTGG - Intronic
1033296364 7:140140800-140140822 TGTTCTAGTGAACACTGTGCTGG + Intronic
1034009397 7:147511876-147511898 TGCTATAGAAAGCACTTTGAAGG - Intronic
1034883712 7:154781533-154781555 TGTTGTAGAAGGCACTCTGCCGG + Intronic
1034922626 7:155096585-155096607 TGTTACAGAGAGCACCGGGTTGG + Intergenic
1036506846 8:9364666-9364688 TGTTTCAGAGAGCACAGGGCTGG + Intergenic
1037134498 8:15445609-15445631 TGTTTCAGAGAGCACTGGGTTGG + Intronic
1037806619 8:22061333-22061355 TGTTACAGCTGGCACTGTGCTGG - Intronic
1038293651 8:26271624-26271646 TGTTTTAGACACAACTGTGCAGG + Intergenic
1038356000 8:26830040-26830062 TATTAGAGTGAGCACTGTCCTGG + Intronic
1039807573 8:41014219-41014241 TGTTTCAGAGAGCACGGGGCTGG + Intergenic
1045055379 8:98363981-98364003 TGTGATAGAGAGAACAGCGCTGG - Intergenic
1045117341 8:98997597-98997619 TGTCATAGACAGCATTGTACAGG + Intergenic
1050002621 9:1094561-1094583 TGCTATAGAAAGCACTATGGCGG - Intergenic
1052259342 9:26493674-26493696 TGTTTCAGAGAGCACTGGGTTGG - Intergenic
1053081585 9:35182764-35182786 TGTTTCAGAGAGCACTGGGTTGG + Intronic
1053701123 9:40691639-40691661 TATGTTACAGAGCACTGTGCCGG - Intergenic
1054312416 9:63491037-63491059 TATGTTACAGAGCACTGTGCCGG - Intergenic
1054411188 9:64815095-64815117 TATGTTACAGAGCACTGTGCCGG - Intergenic
1056663367 9:88560890-88560912 GGATATTGAGAGCACTGCGCTGG + Intronic
1057705003 9:97389806-97389828 TGTAAGATAGTGCACTGTGCAGG - Intergenic
1059525884 9:114990549-114990571 TGTTATGCAAGGCACTGTGCTGG + Intergenic
1059595428 9:115715038-115715060 TGGTAGAGAGAGCACTGGACTGG + Intergenic
1059935971 9:119311058-119311080 TGCTATAAAGAGAAATGTGCAGG - Intronic
1060057973 9:120432110-120432132 TATTATAAAGAACACTGTACTGG - Intronic
1061635991 9:131908579-131908601 TGTTTCAGAGAGCACTGGGTTGG - Intronic
1188454288 X:30345138-30345160 TCTTATAGAGAGCACGGAGCTGG - Intergenic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1190159168 X:48017541-48017563 TGTTTCAGAGAGCACGGGGCTGG - Intronic
1190174880 X:48139769-48139791 TGTTTCAGAGAGCACGGGGCTGG - Intergenic
1192499998 X:71644663-71644685 TGTTTCAGAGAGCACGGGGCTGG + Intergenic
1192729269 X:73786183-73786205 TGTTAGAAACACCACTGTGCTGG + Intergenic
1195716574 X:107824848-107824870 TGTGCTAGAGAGCACTGAGGTGG - Intergenic
1197455865 X:126674627-126674649 TGTTTCAGAGAGCACTGGGTTGG - Intergenic
1199085346 X:143622201-143622223 CGTTATTCAGAGAACTGTGCAGG - Intergenic
1199896149 X:152129752-152129774 TGTTTCAGAGAGCACGGGGCTGG - Intergenic
1202127438 Y:21580947-21580969 AGATATAGGGAGCACTGTGTTGG - Intergenic