ID: 1027649355

View in Genome Browser
Species Human (GRCh38)
Location 7:80846228-80846250
Sequence TTGTAGGTGCATAAAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027649355_1027649357 -1 Left 1027649355 7:80846228-80846250 CCTTGATCTTTATGCACCTACAA 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1027649357 7:80846250-80846272 ATAGAGCTATCTGTATTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027649355 Original CRISPR TTGTAGGTGCATAAAGATCA AGG (reversed) Intronic
904955434 1:34279732-34279754 TTGTAGTTGCATCACAATCAAGG + Intergenic
906918232 1:50034954-50034976 ATGTAGGTTCTTAAAGGTCAAGG - Intergenic
909327673 1:74372196-74372218 TTATAGGAACATAAAGATAATGG + Intronic
910348939 1:86273918-86273940 CAGTAGGTGCAGAAAGCTCAAGG - Intergenic
917412790 1:174777075-174777097 TTGTGGCTGAGTAAAGATCAAGG - Intronic
920948510 1:210551867-210551889 TTGAAGGTGAATAAAAATCTTGG - Intronic
923655858 1:235916240-235916262 TTGAAGGTGTAATAAGATCAAGG - Intergenic
923891132 1:238215943-238215965 CTGTAAGTTAATAAAGATCAGGG - Intergenic
1069295276 10:66836130-66836152 TTGTAGCTTAATATAGATCATGG - Intronic
1069493129 10:68878690-68878712 TTGTATCTGCATGAAGATAAAGG - Intronic
1073657879 10:105437019-105437041 TTTGAGTTGCATAAACATCAAGG - Intergenic
1074703291 10:116110721-116110743 TTGTGGGTGCTTAGTGATCATGG - Intronic
1074937929 10:118204572-118204594 TTGCAGGAGCAGAAAGATCTAGG - Intergenic
1077657694 11:4037462-4037484 TACTAGGTGCATAAAGATTTAGG + Intronic
1078941479 11:16011371-16011393 TTGTAGTTTTATAAATATCATGG + Intronic
1079710512 11:23678106-23678128 TTTTAGGAGCATAAGGATTAGGG + Intergenic
1080106513 11:28516910-28516932 TTGTTGGATCATAAAGTTCAAGG + Intergenic
1085590519 11:77755458-77755480 TTGTTTGTACATAAAGATGATGG + Intronic
1085821121 11:79794803-79794825 TTGTAAGTACATAAAGACCAAGG + Intergenic
1087009980 11:93504150-93504172 TTGGAGTTGCAGAAATATCATGG - Intronic
1087952094 11:104234626-104234648 TTTTAGGTGCATAAATATTTAGG + Intergenic
1088546727 11:110966617-110966639 GGATTGGTGCATAAAGATCAAGG + Intergenic
1089722423 11:120439424-120439446 TGGTGGGTGCATAGAGGTCAGGG + Intronic
1090132543 11:124159792-124159814 TTGTAGATGCATAAAAATGAGGG - Intergenic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1096316657 12:50573420-50573442 TTGTAGGTGGCTACAGACCAGGG - Intronic
1099576258 12:84386918-84386940 TGTTAGGTGCATAAACATTAAGG + Intergenic
1102220772 12:111192989-111193011 TTTTAGGTGCTTAAAAATGATGG - Intronic
1102935418 12:116892355-116892377 TTGTAGCTACATAGACATCAGGG + Intergenic
1106562632 13:30859829-30859851 TCGTAGGTGCTGAAAGAGCATGG + Intergenic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1110661983 13:78067235-78067257 TTGTAGCTTCATAAAGAAAAGGG + Intergenic
1111485416 13:88892707-88892729 TTACAGGAGCATAAAGATAATGG - Intergenic
1112317797 13:98379938-98379960 TTGCAGGTGAATAAGGATAAAGG - Intronic
1114802629 14:25795375-25795397 ATATATGTGCTTAAAGATCAAGG - Intergenic
1117352525 14:54895533-54895555 TTACAGGGGCATGAAGATCAAGG + Intronic
1117618481 14:57559322-57559344 TTGTAGGTGAAATAAGAACAGGG - Intergenic
1119229941 14:72971769-72971791 TCATAGATACATAAAGATCAAGG - Intronic
1119364610 14:74080946-74080968 TTGCAGGAGCATAGAGAACAGGG - Intronic
1121812223 14:96901234-96901256 TTCTAGGTGCCAAAAAATCATGG - Intronic
1123196113 14:106618394-106618416 TTGTAGGTAAAAAAAAATCATGG + Intergenic
1131981694 15:98000515-98000537 TTGTATTTGAATAAAGATAATGG - Intergenic
1132390003 15:101431647-101431669 TTGCAGGTGCAGAAAAAGCAAGG - Intronic
1137482442 16:48863849-48863871 TTTCTAGTGCATAAAGATCAAGG - Intergenic
1138023636 16:53505303-53505325 TTGTAGGGGCACAAGGCTCACGG + Intergenic
1139262148 16:65604744-65604766 TTGAAGGTGCTTCAAAATCATGG + Intergenic
1140075131 16:71691538-71691560 TTTTAGGTACAAAAAGAACATGG + Intronic
1141258454 16:82427140-82427162 TTGTAAGGGCAGAAAGACCATGG - Intergenic
1147762319 17:42807070-42807092 TTATAGCTGCATAAAACTCAAGG + Intronic
1153825953 18:8875168-8875190 TTCTAGGTGCATATATACCAGGG + Intergenic
1157493384 18:48139030-48139052 CTGTGGGTGCATAAGGAACAGGG + Intronic
1157939450 18:51911186-51911208 TTGTAGATGGATAAAAATAATGG - Intergenic
1165588264 19:36941474-36941496 TTATATGTGCTTAAAGAACAAGG - Intronic
1168541966 19:57220433-57220455 TTTGAAGTGCCTAAAGATCAGGG + Exonic
926460362 2:13122503-13122525 TTCTAAGTGCATAAAAAGCAGGG - Intergenic
927372387 2:22371499-22371521 CTGCAGGTGCCTAAAGATCTTGG + Intergenic
934123553 2:88863889-88863911 TTGTAGGTGCAAAAACTTGAGGG + Intergenic
934791352 2:97064670-97064692 TTGTAAGTGCATAAAACTGAAGG + Intergenic
934815081 2:97317873-97317895 TTGTAAGTGCATAAAACTGAAGG - Intergenic
934822614 2:97390610-97390632 TTGTAAGTGCATAAAACTGAAGG + Intergenic
935100418 2:99989393-99989415 TTGTATGTCCATAAAGCTGATGG - Intronic
935609350 2:105004986-105005008 TTGTGTGTGCATAAAATTCATGG + Intergenic
939445801 2:142309067-142309089 ATGTAGATGCATAAAAAGCAGGG - Intergenic
940250276 2:151667819-151667841 TTGTTGCTGCAAAAAGTTCAAGG - Exonic
942994034 2:182238625-182238647 TAGTAGGTGCATAAAAATAGTGG - Intronic
943876771 2:193075793-193075815 CTGAAGGTGCATAAACATAATGG - Intergenic
946316441 2:218917305-218917327 TTTTAGGTGCATAAACATTTAGG + Intergenic
1169306116 20:4491951-4491973 ATGTGGGTGCCTAAAGGTCAAGG + Intergenic
1169335496 20:4752584-4752606 TTTTAGATGCATTTAGATCAGGG + Intergenic
1170147443 20:13192234-13192256 TTGGAGGTACATAAAGAACAGGG + Intergenic
1170994052 20:21334896-21334918 TTGAATGTGTATAAAGCTCAGGG + Intronic
1172090398 20:32427674-32427696 ATGGAGGTGAATAACGATCAGGG - Intronic
1172293778 20:33793587-33793609 GAGTAGGTGGATAATGATCATGG + Intergenic
950089172 3:10283059-10283081 TTGTAGGTGGATTCAGATTAAGG + Intronic
951134306 3:19085351-19085373 TTGTAGGTGCATACATATTAAGG - Intergenic
953369467 3:42375122-42375144 TTTTTGGTGCCTAAAAATCAAGG + Intergenic
953515628 3:43588815-43588837 TTTTGGCTGCATAAAGATCTTGG - Intronic
955231708 3:57105184-57105206 TTCAAGGAGCATAAAGCTCAGGG + Intronic
955613673 3:60783456-60783478 TTGTCAGTGGATAAAGAACAAGG + Intronic
955654959 3:61235467-61235489 TTTTATGTGCAGATAGATCATGG + Intronic
955980071 3:64515885-64515907 TTGGAGGGGCAGAAAGACCATGG + Exonic
956707512 3:72011937-72011959 TTGTAGGAGGTTAAGGATCAAGG + Intergenic
956773690 3:72548074-72548096 TAGTAGGTGCTCAAAGAACAGGG - Intergenic
957217233 3:77336199-77336221 TTGTAGGTGAATAAAGAGCCAGG + Intronic
957738031 3:84227062-84227084 CTGCAGGTGCATAAATAACAGGG + Intergenic
960518779 3:118631364-118631386 GTGTAGGTGAAGAAAGGTCATGG - Intergenic
960849717 3:122039519-122039541 TTTTTGCTGCATAAAGAACATGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965212940 3:165818774-165818796 TTGTAGATGCAAATAGATCTGGG - Intronic
974198110 4:58603167-58603189 TTGAAGGGTCATAAGGATCAGGG - Intergenic
980407735 4:132375307-132375329 TTATATGTGCAAAAATATCAGGG + Intergenic
983706701 4:170669391-170669413 TTTTAGGTCAATAAAGAACAGGG + Intergenic
986135059 5:4969191-4969213 TTGTAGGTTTCTAAAGAGCAAGG - Intergenic
987938905 5:24506331-24506353 ATGTAGTTGGATAAAGATAATGG - Intronic
989161649 5:38397038-38397060 GTGGATGTGCATAAAGATAAAGG + Intronic
993528745 5:88999720-88999742 TTATAGGTTGATAAAGATGAAGG + Intergenic
993843088 5:92905419-92905441 TTGTAAATTCATAGAGATCAGGG + Intergenic
997313631 5:132913243-132913265 TTTTAGGTGCATAAACATTTAGG - Intronic
1004327293 6:14686820-14686842 TTCTAAGTGGATAAAGAGCAGGG + Intergenic
1004665084 6:17741906-17741928 TTGTAGGTGTCTAAAGTTGATGG + Intergenic
1005596696 6:27385590-27385612 TTTTAGGTGCATACATATTAAGG - Intronic
1006785626 6:36664939-36664961 GTGTGGCTGAATAAAGATCAGGG - Intergenic
1008306334 6:49905750-49905772 TTATATTTGCATAAAAATCAAGG + Intergenic
1010855327 6:80830720-80830742 ATGTAGTTGAATAAAGATAAAGG - Intergenic
1018791926 6:167155160-167155182 TTATATATGCATTAAGATCAGGG + Intronic
1020920960 7:14263693-14263715 TTGTAGATTCATAAAGTTAAAGG + Intronic
1022634166 7:32116220-32116242 TTGTAGGTGCAGAAATAAAAGGG - Intronic
1026246527 7:68625200-68625222 TTGCTGGTGCATATACATCATGG - Intergenic
1027649355 7:80846228-80846250 TTGTAGGTGCATAAAGATCAAGG - Intronic
1028191324 7:87855781-87855803 TTATAGGTTTATAAAGATAATGG - Intronic
1028404871 7:90464360-90464382 CTGTAGGTGCACAGAAATCAAGG + Intronic
1029571117 7:101370221-101370243 TTGCAGGTGCTATAAGATCAGGG - Intronic
1030894897 7:115047030-115047052 TTTTAGGAAAATAAAGATCAAGG - Intergenic
1033014688 7:137660666-137660688 TTCTTGGTACATATAGATCAGGG - Intronic
1033400913 7:141024167-141024189 TTTTAGGTGCATATATATTAAGG + Intergenic
1041509109 8:58634731-58634753 TGGTGGGTGCATAAATATAAAGG + Intronic
1045037292 8:98185510-98185532 TTGCAGGTGTATAAAGTTCATGG - Intergenic
1045500882 8:102743580-102743602 TTGTCAGTGCTTAGAGATCAGGG + Intergenic
1045669950 8:104539585-104539607 ATGTAGGTGAATTAAGATCAGGG + Intronic
1046731627 8:117732366-117732388 ATGTAAGTACATAAAGAGCATGG - Intergenic
1052399840 9:27986643-27986665 AGGTAGGTGCAAACAGATCATGG + Intronic
1055620010 9:78115242-78115264 TTATAGGTGGATATAGGTCAAGG - Intergenic
1058643115 9:107106142-107106164 TTGGAGGTGAAGAAAAATCAGGG + Intergenic
1058804624 9:108578918-108578940 TTGTTGGGGCATAAAATTCAGGG + Intergenic
1058999568 9:110334638-110334660 TTGTAAGTACATAAAAATCATGG + Intronic
1061291581 9:129653479-129653501 ATGTAGGAGCAAGAAGATCAGGG - Intergenic
1186227457 X:7415677-7415699 TTTTAGGTGTATCTAGATCAGGG - Intergenic
1198896684 X:141463373-141463395 TTGTAGGTGCATACACATTAAGG + Intergenic
1201899306 Y:19031819-19031841 TTATGGGTGAGTAAAGATCATGG - Intergenic