ID: 1027651337

View in Genome Browser
Species Human (GRCh38)
Location 7:80872511-80872533
Sequence GCTGAATTCTCGGCCGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 7, 3: 80, 4: 548}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027651337 Original CRISPR GCTGAATTCTCGGCCGGGCG TGG Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
900275404 1:1822950-1822972 TCTGATTTCTAGGCCGGGCGTGG + Intronic
900434515 1:2622592-2622614 ACCAAATTCTTGGCCGGGCGCGG + Intronic
901279336 1:8020833-8020855 AATGAAATCTGGGCCGGGCGTGG - Intronic
901316530 1:8313792-8313814 GGTGCATTCTCGGCCGGGCATGG - Intergenic
901367058 1:8761625-8761647 GTTAGATTCTCGGCCGGGCATGG + Intronic
901625373 1:10621633-10621655 AAAGAATTCTTGGCCGGGCGCGG - Intronic
902461438 1:16580336-16580358 TAAGAAGTCTCGGCCGGGCGCGG - Intronic
902462223 1:16586635-16586657 TAAGAAGTCTCGGCCGGGCGCGG - Intronic
902588769 1:17458546-17458568 GACGAAGTCTCGGCCGGGCGCGG - Intergenic
903337123 1:22632623-22632645 GATGGATACTGGGCCGGGCGCGG + Intergenic
905073780 1:35251456-35251478 GTATATTTCTCGGCCGGGCGCGG - Intergenic
905113049 1:35611531-35611553 GATGAAGTCTTGGCCGGGCACGG + Intronic
906303895 1:44704014-44704036 GATGGATTCCCGGCCGGGTGCGG - Intronic
906487944 1:46246248-46246270 AAAGAATTCTGGGCCGGGCGCGG - Intergenic
907114670 1:51958431-51958453 GTGGCATACTCGGCCGGGCGCGG + Intronic
908167010 1:61468660-61468682 GTGGATTTCCCGGCCGGGCGCGG - Intergenic
908265400 1:62373992-62374014 TCTGAAGTCTGGGCTGGGCGCGG + Intergenic
909194469 1:72599764-72599786 TCTTAAGACTCGGCCGGGCGCGG + Intergenic
909783336 1:79577313-79577335 AAAGATTTCTCGGCCGGGCGCGG - Intergenic
910255443 1:85242696-85242718 AAAGAATTCTTGGCCGGGCGTGG - Intergenic
910887692 1:91983542-91983564 TTTGAATTCTAGGCCAGGCGTGG - Intronic
910895343 1:92063847-92063869 GCTGACATCTTGGCTGGGCGTGG + Intergenic
911008686 1:93255239-93255261 GCTGACTCTTCGGCCGGGCACGG - Intronic
911364443 1:96919761-96919783 AATAAATTCCCGGCCGGGCGCGG - Intergenic
911933214 1:103931727-103931749 TAAGAATTCACGGCCGGGCGCGG - Intergenic
912752572 1:112297969-112297991 ACTGAATTCTCTGCCTGGGGTGG - Intergenic
913028806 1:114875547-114875569 GACAAAGTCTCGGCCGGGCGCGG - Intronic
913584872 1:120264865-120264887 TATGTATTTTCGGCCGGGCGTGG + Intergenic
913623310 1:120633497-120633519 TATGTATTTTCGGCCGGGCGTGG - Intergenic
914566873 1:148876721-148876743 TATGTATTTTCGGCCGGGCGTGG + Intronic
914605949 1:149253520-149253542 TATGTATTTTCGGCCGGGCGTGG - Intergenic
914862577 1:151398947-151398969 TGTGACTTCTAGGCCGGGCGAGG + Intergenic
915392568 1:155557568-155557590 AATGATTTCTAGGCCGGGCGTGG - Intronic
915716170 1:157947102-157947124 GGTCAATTCTTGGCCGGGCGCGG - Intergenic
915937743 1:160098883-160098905 GCTGGAGTCTTGGCGGGGCGGGG - Intronic
915985012 1:160455844-160455866 GCAGACTTCTTGGCTGGGCGCGG - Intergenic
916768857 1:167888584-167888606 GCTGATTTTTGGGCCGGGCGCGG + Intronic
917871981 1:179250119-179250141 GATGGAGTCTAGGCCGGGCGCGG - Intergenic
918223415 1:182456586-182456608 GATTACTTCTCGGCCAGGCGTGG - Intronic
918977708 1:191512423-191512445 GATGATCTCTCGGCCGGGCGCGG + Intergenic
919904893 1:202071676-202071698 GAAGAATTATGGGCCGGGCGTGG + Intergenic
919949000 1:202345192-202345214 ACTGAATTCTTGGCTGGGCGCGG + Intergenic
920091930 1:203460564-203460586 TATGAATTGTCGGCCGGGCGCGG + Intergenic
920991873 1:210947277-210947299 GCTCAATTCTTGGCCAGGCGCGG + Intronic
921107902 1:212001339-212001361 GAGGAATTCTGGGCCGGGCGTGG - Intronic
921656439 1:217744170-217744192 AAAGAATTTTCGGCCGGGCGCGG + Intronic
922625465 1:227036718-227036740 ACTGAATTGAAGGCCGGGCGCGG - Intronic
922946082 1:229515414-229515436 GATGAATTCCCGGCCAGGCATGG - Intergenic
923178446 1:231492580-231492602 TAAGATTTCTCGGCCGGGCGCGG + Intergenic
923552959 1:234978776-234978798 GCTGAATTATCTGCAGTGCGTGG - Intergenic
924006450 1:239617432-239617454 GGTGAATTTTTGGCCAGGCGTGG + Intronic
924031959 1:239894721-239894743 GAAGACTTCTCGGTCGGGCGCGG - Intronic
924549723 1:245064011-245064033 GTTGAGATCTGGGCCGGGCGTGG - Intronic
924551252 1:245080013-245080035 GCTGAATTTTCTGCCGAGAGTGG + Intronic
924855659 1:247872937-247872959 GATGAACTCTGGGCCGGGCGCGG + Intronic
1062866912 10:863517-863539 GATGAAACCTGGGCCGGGCGCGG - Intronic
1064401646 10:15026196-15026218 GACAAATTCTCGGCCGGGCGCGG - Intergenic
1064472228 10:15647750-15647772 ACTGAATAATTGGCCGGGCGCGG - Intronic
1064592544 10:16909173-16909195 GATGACATCTTGGCCGGGCGCGG - Intronic
1065305283 10:24362708-24362730 TCTAATTTCTGGGCCGGGCGCGG + Intronic
1065395179 10:25228739-25228761 GATGATTTGTAGGCCGGGCGTGG + Intronic
1065586934 10:27228001-27228023 GATGGAATCTCGGCCGGGCGCGG - Intronic
1065791614 10:29265715-29265737 GCTGAAATCTCAGCCGGGCACGG + Intergenic
1065883184 10:30054957-30054979 GATGCATTTTCGGCCGGGCGCGG - Intronic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1067015060 10:42752489-42752511 TGTAAATTGTCGGCCGGGCGCGG - Intergenic
1067865029 10:49895694-49895716 TATCAGTTCTCGGCCGGGCGCGG - Intronic
1068527637 10:58148374-58148396 ACTCAATTCTTGGCCGGGCGCGG - Intergenic
1069866930 10:71509985-71510007 GCTGAACTCTCAGCAGGGAGTGG - Intronic
1069990349 10:72311405-72311427 CCTGCATTCAAGGCCGGGCGCGG + Intergenic
1070193514 10:74133941-74133963 ACTGAAGTCCTGGCCGGGCGCGG - Intronic
1070199016 10:74185540-74185562 GCAGAGTCGTCGGCCGGGCGCGG + Intronic
1070213974 10:74356306-74356328 TATGAATTATTGGCCGGGCGCGG - Intronic
1072977860 10:100074705-100074727 GCAGGGTTTTCGGCCGGGCGTGG - Intronic
1072984676 10:100129402-100129424 GCTGCAGTCTGGGCTGGGCGTGG - Intergenic
1073258402 10:102170379-102170401 CCTCCCTTCTCGGCCGGGCGCGG - Intergenic
1073335355 10:102703731-102703753 GATGAGTCCTGGGCCGGGCGTGG - Intronic
1073505943 10:103989756-103989778 GCCAAATTGTTGGCCGGGCGCGG - Intronic
1075152398 10:119945739-119945761 GAAAAAATCTCGGCCGGGCGCGG - Intergenic
1075218671 10:120563508-120563530 CTTGAATTTTAGGCCGGGCGCGG + Intronic
1075775196 10:124978906-124978928 GAAGAATTATCGGCCGGGCCTGG + Intronic
1076504585 10:130963365-130963387 GATGAATTGTCGGCAGGGCGCGG + Intergenic
1076729982 10:132433595-132433617 GCTGGCTTCTGGGCTGGGCGTGG - Intergenic
1077121857 11:912552-912574 ACTGACTTCTTGGCTGGGCGCGG + Intronic
1077595642 11:3529244-3529266 GATAAAAGCTCGGCCGGGCGCGG + Intergenic
1078421742 11:11218265-11218287 GCAGAATTCTCTGCAGGGCAAGG + Intergenic
1079914330 11:26349836-26349858 AAACAATTCTCGGCCGGGCGTGG - Intronic
1081972746 11:47211274-47211296 GCTGAGATCACGGCCAGGCGTGG - Intergenic
1081979348 11:47257018-47257040 AATATATTCTCGGCCGGGCGCGG - Intronic
1083182191 11:60994148-60994170 GCTGAATTTCTGGCCGGGCGCGG + Intronic
1083223704 11:61270207-61270229 GCTGTAAGCTGGGCCGGGCGCGG - Intronic
1083344554 11:61980183-61980205 GCTGGATGCTGGGCTGGGCGCGG + Intergenic
1083791887 11:64991078-64991100 GCTGAGTCCAGGGCCGGGCGCGG - Intronic
1084251535 11:67903225-67903247 GATAAAAGCTCGGCCGGGCGCGG + Intergenic
1084299473 11:68237524-68237546 TGACAATTCTCGGCCGGGCGTGG - Intergenic
1085092837 11:73733256-73733278 GCTGTATTTTAGGCCAGGCGCGG + Intronic
1085318478 11:75560376-75560398 GATAAATTCTAGGCTGGGCGCGG - Intergenic
1085472892 11:76769377-76769399 GCTCAAATCTCAGCCGGGCCAGG - Intergenic
1087300448 11:96427596-96427618 AATGAAACCTCGGCCGGGCGCGG - Intronic
1087532723 11:99405597-99405619 TCTGAATTCCTGGCCGGGCGCGG + Intronic
1087852188 11:103044959-103044981 GATGAGTTTTCGGCCGGACGCGG - Intergenic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1088295202 11:108286039-108286061 GTTAAATTCTTGGCCGGGTGCGG + Intronic
1088311055 11:108461013-108461035 GCAGACTTTTTGGCCGGGCGTGG - Intronic
1088885490 11:114003107-114003129 TTTGAATTCTTGGCCGGGCGCGG + Intergenic
1089513991 11:119019729-119019751 GATGACACCTCGGCCGGGCGCGG - Intronic
1089573899 11:119427817-119427839 GGTGACATCTAGGCCGGGCGCGG + Intergenic
1090328231 11:125907316-125907338 GTTGAAGTGTTGGCCGGGCGCGG + Intronic
1090422553 11:126585522-126585544 GGTTAATTCCTGGCCGGGCGCGG - Intronic
1090720015 11:129463193-129463215 CAAAAATTCTCGGCCGGGCGCGG - Intergenic
1090773598 11:129944302-129944324 ATTGCAATCTCGGCCGGGCGCGG + Intronic
1090789998 11:130083954-130083976 TCCGATTTCTCGGCCGGGCGCGG + Intronic
1091878020 12:3952629-3952651 AAAGAATTATCGGCCGGGCGCGG - Intergenic
1092421803 12:8338014-8338036 GATAAAAGCTCGGCCGGGCGCGG + Intergenic
1092485708 12:8900613-8900635 GCTGAAATGAGGGCCGGGCGCGG - Intergenic
1092566488 12:9671508-9671530 GGTTAATCCTCGGCCGGGCGCGG - Intronic
1092940304 12:13401867-13401889 GCTAAGTGCTAGGCCGGGCGTGG + Intergenic
1093716773 12:22391789-22391811 AATGAAGTCTGGGCCGGGCGCGG + Intronic
1094130432 12:27068930-27068952 ACCGAAGTCTCGGCCGGGCGCGG - Intergenic
1094392746 12:29970357-29970379 GCTGAGTTCTGGGCCTGGTGGGG + Intergenic
1094542870 12:31377100-31377122 GGTAATTTCTAGGCCGGGCGCGG + Intergenic
1095203747 12:39415545-39415567 GAAGCATTCTCGGCCGGGCGCGG - Intronic
1095546266 12:43373967-43373989 GATGATATTTCGGCCGGGCGCGG - Intronic
1096448762 12:51719784-51719806 AAAGAATTCTTGGCCGGGCGCGG + Intronic
1096537163 12:52282524-52282546 GCTCAAAACTTGGCCGGGCGCGG - Intronic
1097037819 12:56135460-56135482 GCTGAATGTTGGGCCGGGCACGG - Intronic
1098190736 12:67945720-67945742 GCTGGATTTTTGGCCGGGCGCGG - Intergenic
1100187545 12:92153970-92153992 GATGAAGTCACAGCCGGGCGCGG + Intergenic
1100676556 12:96874905-96874927 GCAGAGATCCCGGCCGGGCGCGG - Intronic
1101061815 12:100980028-100980050 AAGGATTTCTCGGCCGGGCGTGG - Intronic
1101656710 12:106727907-106727929 ACTGAATTCAGGGCCGGGCGCGG - Intronic
1102048947 12:109848284-109848306 GATGTTTTCTTGGCCGGGCGTGG - Intergenic
1102094858 12:110230022-110230044 GCTGCATTACAGGCCGGGCGCGG + Intergenic
1102343221 12:112140128-112140150 ACTGAATTGGAGGCCGGGCGTGG + Intronic
1102389511 12:112538096-112538118 GCTGAAATCTGGGCTGGGTGTGG - Intergenic
1102915280 12:116747898-116747920 GATGAACCCTCGGCCGGGCACGG + Intronic
1102937918 12:116912751-116912773 GAATTATTCTCGGCCGGGCGCGG - Intronic
1103124467 12:118409433-118409455 ACAGAATTTTAGGCCGGGCGTGG - Intronic
1103388234 12:120550884-120550906 GCCGCATTCTGGGCCGGGTGTGG - Intronic
1103406903 12:120682161-120682183 CCTCAATTCTTGGCTGGGCGTGG - Intergenic
1103818613 12:123679085-123679107 GCTGAATTATCGGCCAGGCGCGG - Intronic
1104234904 12:126924562-126924584 TCAGTCTTCTCGGCCGGGCGCGG + Intergenic
1104459463 12:128943035-128943057 ACTGGAATCTAGGCCGGGCGTGG - Intronic
1105966855 13:25392783-25392805 ACTGGATTCTAAGCCGGGCGTGG + Intronic
1107674821 13:42784525-42784547 TTTCAGTTCTCGGCCGGGCGCGG + Intronic
1107773151 13:43810225-43810247 CCTTTATTCTGGGCCGGGCGCGG - Intergenic
1107874984 13:44782491-44782513 GAGGAATTCTCAGCCGGGCACGG - Intergenic
1108101992 13:46966667-46966689 GATTCTTTCTCGGCCGGGCGCGG + Intergenic
1109213773 13:59564408-59564430 GCTACATAATCGGCCGGGCGCGG - Intergenic
1109966052 13:69698064-69698086 ACTGATTTTTTGGCCGGGCGCGG + Intergenic
1110200835 13:72848553-72848575 ACTTAACTCTTGGCCGGGCGCGG + Intronic
1110435632 13:75474925-75474947 GTTAAATTATGGGCCGGGCGTGG - Intronic
1110859668 13:80334075-80334097 ACTGAATTAGAGGCCGGGCGCGG + Intergenic
1111028216 13:82562272-82562294 ATTAAATTTTCGGCCGGGCGCGG - Intergenic
1111133419 13:84006082-84006104 TATTAATTCTTGGCCGGGCGTGG + Intergenic
1112014518 13:95320531-95320553 GCTGAACTCATGGCCGGGTGTGG + Intergenic
1112710421 13:102120992-102121014 GATCACTTTTCGGCCGGGCGCGG - Intronic
1113056030 13:106269046-106269068 GGGAAATTCTGGGCCGGGCGTGG + Intergenic
1113079398 13:106501880-106501902 AATAAATTCTGGGCCGGGCGCGG - Intronic
1113810014 13:113134948-113134970 TATCAATTTTCGGCCGGGCGCGG + Intronic
1113946590 13:114048023-114048045 ACGGAGGTCTCGGCCGGGCGCGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1115258426 14:31427509-31427531 GATTATTTGTCGGCCGGGCGTGG + Intronic
1115473224 14:33789877-33789899 GTTGTACTCTAGGCCGGGCGCGG - Intronic
1115556683 14:34549810-34549832 ACGGAACTGTCGGCCGGGCGCGG + Intergenic
1116851309 14:49912395-49912417 ACTTACTTTTCGGCCGGGCGTGG + Intergenic
1117128592 14:52660122-52660144 ACTGATTTCTTGGCTGGGCGTGG - Intronic
1117769012 14:59113333-59113355 GATGCCTTCACGGCCGGGCGCGG - Intergenic
1118619287 14:67600114-67600136 GCAGAATTCCCGGCAGGACGGGG + Exonic
1118843612 14:69529707-69529729 GCTGAAATCTCTGCAGGGAGAGG - Exonic
1119040691 14:71271758-71271780 AATGAATTATGGGCCGGGCGTGG + Intergenic
1119080298 14:71686696-71686718 GTTGACTTCTAGGCCAGGCGTGG - Intronic
1119231151 14:72980844-72980866 AATAAATTCTCGGCCGGGCACGG - Intronic
1119797052 14:77408156-77408178 GGTGAATTATAGGCCAGGCGTGG - Intronic
1120894200 14:89515211-89515233 GGAGCATTCTTGGCCGGGCGTGG - Intronic
1121352744 14:93186157-93186179 CAAGAATTCTAGGCCGGGCGCGG - Intronic
1122189619 14:100030390-100030412 GAGGTAATCTCGGCCGGGCGCGG - Intronic
1122528752 14:102409587-102409609 GCTGAATTCTTGGCTGGGCGTGG - Intronic
1124472791 15:30003094-30003116 GCAAAATTTTCGGCCGGGCGTGG - Intergenic
1124477998 15:30052312-30052334 GATAAAATCTTGGCCGGGCGCGG - Intergenic
1124507798 15:30293834-30293856 GATGATTTTCCGGCCGGGCGCGG + Intergenic
1124611171 15:31209972-31209994 GCTGATGGGTCGGCCGGGCGCGG + Intergenic
1124735758 15:32244824-32244846 GATGATTTTCCGGCCGGGCGCGG - Intergenic
1125553827 15:40568076-40568098 GTTAGATTCTTGGCCGGGCGCGG + Intergenic
1127010440 15:54620583-54620605 GCTCTATTCTCGGCTGGGCATGG + Intronic
1127113620 15:55701244-55701266 TCTGCATTCTTGGCCGGGCGCGG + Intronic
1128423442 15:67516787-67516809 AATGAATTTTAGGCCGGGCGTGG - Intergenic
1129795544 15:78373428-78373450 TTTGAATTCTGGGCCGGGCATGG - Intergenic
1129862869 15:78876224-78876246 CCCTATTTCTCGGCCGGGCGCGG - Intronic
1129909808 15:79217392-79217414 GCTGAAATTTCGGCAGGGCTTGG + Intergenic
1130020154 15:80223345-80223367 GAATAAATCTCGGCCGGGCGCGG - Intergenic
1130299676 15:82670398-82670420 AATGAATTCACGGCCAGGCGTGG - Intronic
1130568129 15:85015844-85015866 GATGACTTGTCGGCTGGGCGTGG + Intronic
1130838510 15:87675016-87675038 CCTGAACTCTTGGCCGGGCATGG - Intergenic
1131624328 15:94101601-94101623 ACTTACTTGTCGGCCGGGCGCGG + Intergenic
1131688480 15:94799276-94799298 GGTGAGTTTTAGGCCGGGCGTGG + Intergenic
1131813024 15:96192657-96192679 ACTGAATAATAGGCCGGGCGCGG - Intergenic
1132522027 16:395888-395910 GCTCAATTGTTGGCCAGGCGTGG + Intergenic
1134394509 16:13851022-13851044 GCTCTTATCTCGGCCGGGCGCGG + Intergenic
1134482929 16:14633941-14633963 AGACAATTCTCGGCCGGGCGCGG - Intronic
1134733346 16:16480232-16480254 AGTGAATTCAGGGCCGGGCGCGG - Intergenic
1134741247 16:16548834-16548856 AATAAATTATCGGCCGGGCGCGG - Intergenic
1135004167 16:18803144-18803166 GATGAAAAATCGGCCGGGCGCGG - Intergenic
1135989825 16:27211274-27211296 GCTGAAGTCTCACCCAGGCGAGG + Intronic
1137413484 16:48249583-48249605 GATGTATTCTAGGCTGGGCGAGG + Intronic
1138127960 16:54454398-54454420 GTTAATTTCTTGGCCGGGCGTGG + Intergenic
1138365665 16:56474608-56474630 GTTGAATTTTGGGCCGGGCATGG - Intronic
1138837526 16:60456889-60456911 TGTGTATTATCGGCCGGGCGCGG + Intergenic
1139772802 16:69292741-69292763 GGTGAACACTCGGCCGGGCGTGG - Intronic
1140557076 16:75934209-75934231 ATTTACTTCTCGGCCGGGCGCGG + Intergenic
1140668254 16:77247928-77247950 TCTGAATACTCGGCTGGGCTGGG + Intronic
1142795810 17:2305987-2306009 ACTGAATTCAAGGCTGGGCGCGG - Intronic
1142872848 17:2832266-2832288 GATAAAGTCTCGGCCGGGCGCGG + Intronic
1142927557 17:3253917-3253939 GATCAAATATCGGCCGGGCGCGG - Intergenic
1143097375 17:4485684-4485706 GATGAACTCTGGGCCAGGCGCGG - Intronic
1143456324 17:7070202-7070224 GAGGCATTGTCGGCCGGGCGCGG + Intergenic
1143774920 17:9192788-9192810 GCTGTTTCCTCGGCCGGGCGCGG + Intronic
1144185719 17:12793415-12793437 CCTGCATTCTAGGCCGGGCGTGG + Intronic
1144251930 17:13426224-13426246 AAAGAATTCTGGGCCGGGCGTGG + Intergenic
1144267653 17:13586575-13586597 ACTGGATTTTAGGCCGGGCGCGG + Intronic
1144691638 17:17269864-17269886 GTTCATTTCTGGGCCGGGCGTGG + Intronic
1145079456 17:19882678-19882700 AATCAAGTCTCGGCCGGGCGCGG + Intergenic
1145951778 17:28824165-28824187 AAAAAATTCTCGGCCGGGCGTGG - Intronic
1146028724 17:29346220-29346242 TCTAAATTCTAGGCTGGGCGTGG - Intergenic
1146165323 17:30583902-30583924 ACTGTACTCTGGGCCGGGCGTGG + Intergenic
1146230201 17:31100856-31100878 GATGAATTCCGGGCCGGGCACGG - Intronic
1147004875 17:37394584-37394606 AGTGCATTCTCGGCCGGGCGCGG + Intronic
1147724946 17:42561302-42561324 GCGAAACTCCCGGCCGGGCGCGG - Intergenic
1147798925 17:43067985-43068007 CCTGAAGTCTCGGCTGGGCGCGG + Intronic
1148326750 17:46787661-46787683 GATGTAGCCTCGGCCGGGCGCGG + Intronic
1148485135 17:47985994-47986016 GTTGTGTTCTAGGCCGGGCGTGG + Intergenic
1148655378 17:49279276-49279298 GTTGAATTCTCAGCCGGGCTCGG - Intergenic
1149497401 17:57128130-57128152 GATTAATTTTCCGCCGGGCGCGG + Intergenic
1149750049 17:59136835-59136857 GATGATTTTTCGGCTGGGCGTGG - Intronic
1149834611 17:59901437-59901459 GATGGAGTCTCGGCCAGGCGCGG - Intronic
1150238538 17:63613172-63613194 GGTGTCTTCCCGGCCGGGCGCGG + Intergenic
1150683939 17:67305187-67305209 GCCGAGCTCCCGGCCGGGCGCGG + Intergenic
1150751844 17:67871059-67871081 GAAGCATTTTCGGCCGGGCGCGG - Intronic
1151331268 17:73410605-73410627 GCAGCATTATCGGCCGGGGGTGG - Intronic
1151461507 17:74256937-74256959 GCTGACTTTTAGGCTGGGCGTGG - Intronic
1151652429 17:75478305-75478327 GATGGAGTCTCGGCCGGGCGCGG - Intronic
1151710991 17:75806481-75806503 GTTAAATTTTGGGCCGGGCGCGG + Intronic
1151773994 17:76185757-76185779 GGAGTAATCTCGGCCGGGCGCGG - Intronic
1152187473 17:78866968-78866990 ACTGAATTGTAGGCCGGGCGCGG + Intronic
1152675665 17:81639605-81639627 GCTGGGGTCTTGGCCGGGCGCGG + Intronic
1153156497 18:2155665-2155687 GTAAAATTCTCGGCCAGGCGCGG + Intergenic
1153829155 18:8905665-8905687 ACTAAAATCTAGGCCGGGCGCGG + Intergenic
1154110000 18:11559666-11559688 AATGACTTCCCGGCCGGGCGCGG + Intergenic
1154344184 18:13528601-13528623 GCTCAACTCTGGGCTGGGCGTGG - Intronic
1154946346 18:21165734-21165756 GATGGATTCTCAGCCGGGTGGGG + Intergenic
1155125983 18:22876127-22876149 ACTTAATTCTTGGCCAGGCGCGG + Intronic
1155211389 18:23605209-23605231 ACAGAATTCTGGGCCGGGCATGG - Intronic
1155343847 18:24839242-24839264 TCTGTATTATCGGCCAGGCGTGG + Intergenic
1155429570 18:25741585-25741607 ACTCAATTCCAGGCCGGGCGTGG + Intergenic
1155603360 18:27574910-27574932 GGTGGAATCTCGGCCGGTCGTGG - Intergenic
1156377344 18:36526691-36526713 GCTGAATTATGGGCCAGGCATGG - Intronic
1158248153 18:55454894-55454916 ACTCAATTCTTGGCTGGGCGTGG + Intronic
1158919430 18:62173923-62173945 GATCATTTCTCGGCCGGGTGCGG + Intronic
1159024698 18:63172489-63172511 AGTGAATTCCCGGCCGGGCGTGG + Intronic
1159142377 18:64413430-64413452 GCCAGATTCTCAGCCGGGCGCGG + Intergenic
1159814445 18:73055190-73055212 ACAGAGTTTTCGGCCGGGCGCGG - Intergenic
1160767530 19:815089-815111 GCGGAAGGCTCGGCCAGGCGGGG + Intronic
1161074133 19:2276732-2276754 GCAGATTCCTGGGCCGGGCGCGG + Intronic
1161116502 19:2499901-2499923 GAAGAATTCTCAGCCAGGCGCGG - Intergenic
1161239812 19:3216054-3216076 GCTTAATTTGCGGCCGGGCGCGG - Intergenic
1161357878 19:3829250-3829272 GCTAAATTCCAGGCTGGGCGTGG - Intronic
1161498436 19:4599713-4599735 AGTTAATTCTAGGCCGGGCGCGG + Intergenic
1161521638 19:4727514-4727536 AATGTATTCTAGGCCGGGCGAGG + Intergenic
1161793019 19:6372199-6372221 TTTGATTCCTCGGCCGGGCGTGG - Intergenic
1161809958 19:6465908-6465930 GCAGGAGTCCCGGCCGGGCGCGG + Intronic
1161831243 19:6606118-6606140 GCTGAATGTGAGGCCGGGCGCGG - Intergenic
1162449014 19:10743194-10743216 GCTGGCATCACGGCCGGGCGTGG - Intronic
1162596807 19:11635748-11635770 GACGGAGTCTCGGCCGGGCGTGG + Intergenic
1162603918 19:11692651-11692673 GCTGTTTTCTGGGCCAGGCGCGG - Intergenic
1162735340 19:12744019-12744041 GATGGAGTCTTGGCCGGGCGTGG - Intronic
1163429272 19:17257319-17257341 GACGGATTCTCGGCCAGGCGCGG - Intronic
1163605487 19:18272898-18272920 GCACAATGCTCGGCCAGGCGCGG - Intronic
1164598227 19:29544234-29544256 ACTGAATGTGCGGCCGGGCGCGG + Intronic
1165175584 19:33927392-33927414 TGTGATTGCTCGGCCGGGCGCGG - Intergenic
1165205570 19:34182545-34182567 AGTCAACTCTCGGCCGGGCGCGG + Intronic
1165341230 19:35213709-35213731 ACAAAATTCTTGGCCGGGCGCGG - Intergenic
1165661491 19:37584670-37584692 GACAAATTCTCGGCCGGGCGCGG + Intronic
1165719393 19:38068317-38068339 TCTGATTTTTCGGCCGGGCGTGG - Intronic
1165931409 19:39361631-39361653 CCTGTCTTCCCGGCCGGGCGCGG + Intronic
1166744326 19:45133372-45133394 CGTGAATTCTGGGCCGGGCGCGG - Intronic
1167047009 19:47055792-47055814 GATGCAGTCTCGGCCGGGCATGG - Intergenic
1167335315 19:48881806-48881828 TCTCCATTCTCGGCCTGGCGCGG - Intronic
1168071216 19:53953040-53953062 ATAAAATTCTCGGCCGGGCGCGG - Intergenic
1168143727 19:54407184-54407206 GTAGAATTGTTGGCCGGGCGTGG + Intergenic
1168603180 19:57736686-57736708 ACCAATTTCTCGGCCGGGCGTGG - Intronic
1202677876 1_KI270711v1_random:24083-24105 TAAGAAGTCTCGGCCGGGCGCGG - Intergenic
925469809 2:4147821-4147843 AATGAGGTCTCGGCCGGGCGCGG - Intergenic
925680893 2:6420375-6420397 TCTGAATTCAGGGCCGGGCGCGG + Intergenic
926089523 2:10041499-10041521 ACTGAACTCAGGGCCGGGCGCGG - Intergenic
926187065 2:10698755-10698777 CAAGAGTTCTCGGCCGGGCGCGG - Intergenic
927794501 2:26036368-26036390 AATGAAGTCTGGGCCGGGCGCGG + Intronic
927900298 2:26814033-26814055 ACAGAATTCCAGGCCGGGCGCGG + Intergenic
929135689 2:38621812-38621834 TAAGAATTCTCGGCAGGGCGCGG + Intergenic
929443286 2:41982947-41982969 TCTGACTTCTGGGCCAGGCGTGG + Intergenic
929721979 2:44378780-44378802 ACTTAATTCTAGGCCAGGCGCGG - Intronic
929891958 2:45925584-45925606 GCAGCATGCTTGGCCGGGCGCGG - Intronic
930653841 2:53989036-53989058 ACTGAATTACAGGCCGGGCGTGG - Intronic
931733029 2:65169845-65169867 GCTCATTTGTTGGCCGGGCGTGG - Intergenic
931820686 2:65949082-65949104 GTTCAATGGTCGGCCGGGCGCGG + Intergenic
932529774 2:72516529-72516551 GTAGAATTCAGGGCCGGGCGTGG - Intronic
932726673 2:74185529-74185551 TCGGAAGTCTGGGCCGGGCGCGG - Intergenic
934096584 2:88611911-88611933 GTTGAATCGTAGGCCGGGCGTGG - Intronic
935058646 2:99589687-99589709 GCTGACATCTGGGCCGGCCGTGG - Intronic
935220772 2:101010592-101010614 AGTTAATTCTCGGTCGGGCGCGG + Intronic
935523879 2:104142671-104142693 GTTGAGATATCGGCCGGGCGCGG + Intergenic
935883404 2:107590054-107590076 GCAAAATTTTCAGCCGGGCGCGG + Intergenic
937918974 2:127117056-127117078 TTTGAAGTCTCGGCCGGGCGCGG - Intergenic
937962677 2:127473093-127473115 ACAGAATTCTTGGCTGGGCGTGG - Intronic
938112422 2:128577913-128577935 GAATAAATCTCGGCCGGGCGCGG + Intergenic
938468582 2:131539034-131539056 ACTGAAATCATGGCCGGGCGCGG + Intergenic
938476877 2:131624083-131624105 AATGAATTCTGGGCCGGGCACGG + Intergenic
941962064 2:171263409-171263431 GTTGAATTCCTGGCCGGGCATGG - Intergenic
942354438 2:175094100-175094122 AATGAACTCTTGGCCGGGCGTGG + Intronic
944826414 2:203487673-203487695 ACTGATTTCTAGGCCGGACGTGG - Intronic
944878516 2:203987178-203987200 ACTGTATTTTGGGCCGGGCGCGG - Intergenic
944957300 2:204826727-204826749 GTTGCATTCTCGGCTGGGCATGG + Intronic
945706831 2:213245813-213245835 TTTGAAATCTCGGCCAGGCGTGG + Intergenic
945760714 2:213910776-213910798 AAAGAATTCTTGGCCGGGCGTGG - Intronic
945924909 2:215793454-215793476 AATAAATTCTCGGCCAGGCGCGG - Intergenic
946338377 2:219053600-219053622 GTGGAATCCTGGGCCGGGCGTGG + Intergenic
946844165 2:223844544-223844566 ACTAAATTCTGGGCTGGGCGCGG + Intergenic
947514072 2:230785872-230785894 GATGGAGTCTTGGCCGGGCGCGG + Intronic
947552305 2:231055192-231055214 AGTGAATTCCTGGCCGGGCGCGG - Intergenic
947968113 2:234299468-234299490 ACTGAGTTCAGGGCCGGGCGAGG + Intergenic
948302906 2:236921750-236921772 GATGATTTTTCGGCAGGGCGCGG + Intergenic
1169243289 20:4003257-4003279 GAAAAATTCTGGGCCGGGCGTGG - Intronic
1169249718 20:4051099-4051121 ACTTAATCCTCGGCCGGGCATGG + Intergenic
1169603945 20:7293991-7294013 AATGTATTGTCGGCCGGGCGCGG - Intergenic
1170937997 20:20826187-20826209 AATAAATTCTAGGCCGGGCGCGG - Intergenic
1171081028 20:22184899-22184921 TCTCCAATCTCGGCCGGGCGCGG + Intergenic
1172370987 20:34391041-34391063 GATTAAATCTAGGCCGGGCGTGG - Intronic
1172414229 20:34751078-34751100 TGTGAAGTGTCGGCCGGGCGCGG + Intronic
1172544337 20:35747715-35747737 GAAGAAATCTAGGCCGGGCGTGG + Intergenic
1174251832 20:49225743-49225765 AGAGAGTTCTCGGCCGGGCGCGG - Intronic
1174252060 20:49227150-49227172 CCTTTACTCTCGGCCGGGCGCGG - Intronic
1174332545 20:49831618-49831640 GCTGAATTCTCTGCAGGGAGAGG + Intronic
1174366256 20:50058317-50058339 AGTGCACTCTCGGCCGGGCGTGG - Intergenic
1174445588 20:50588788-50588810 AAAGAATTCTAGGCCGGGCGCGG + Intronic
1174778468 20:53367103-53367125 ACTTTATTCTCAGCCGGGCGTGG + Intronic
1175438984 20:58977506-58977528 GAAGAATTCTGGGCCGGGTGCGG - Intergenic
1176157666 20:63630132-63630154 GATGGAGTCTCGGCCGGGCGCGG + Intergenic
1177615673 21:23515759-23515781 TATGCAATCTCGGCCGGGCGCGG + Intergenic
1178575293 21:33782733-33782755 TGTTAATTCTTGGCCGGGCGTGG + Intronic
1179031211 21:37720995-37721017 AATGTTTTCTCGGCCGGGCGCGG - Intronic
1179341190 21:40511699-40511721 AAAGTATTCTCGGCCGGGCGCGG + Intronic
1179524941 21:41969809-41969831 CTTGAAAACTCGGCCGGGCGCGG - Intergenic
1180069477 21:45429189-45429211 GCTGTAGTCTCGGCTGGGCGCGG - Intronic
1180556909 22:16585573-16585595 TTTAAACTCTCGGCCGGGCGTGG - Intergenic
1180633363 22:17245011-17245033 AGTGAATTCTCGGCTGGGCGAGG - Intergenic
1180798195 22:18617984-18618006 ACTTAATTTTTGGCCGGGCGCGG + Intergenic
1181156541 22:20925346-20925368 TTTTAATTCTGGGCCGGGCGTGG + Intronic
1181223523 22:21377282-21377304 ACTTAATTTTTGGCCGGGCGCGG - Intergenic
1181293248 22:21814540-21814562 GATGAAGTCTCGGCTGGGCACGG + Intronic
1181714136 22:24712135-24712157 GTTGACTGCTCGGCCGGGCGCGG - Intergenic
1182635336 22:31722137-31722159 ACTTAAATCTGGGCCGGGCGCGG + Intronic
1185300170 22:50075419-50075441 GCTGAATTCCCAGCCAGGCACGG + Intronic
949183271 3:1160107-1160129 ACTGAATGATTGGCCGGGCGTGG - Intronic
949635438 3:5976839-5976861 GAAGCATTTTCGGCCGGGCGTGG - Intergenic
950246741 3:11427525-11427547 AATAAATTATCGGCCGGGCGAGG + Intronic
950501563 3:13367144-13367166 GTTTAATTCACGGCCGGGCATGG + Intronic
950749686 3:15118869-15118891 AAAGAATTCTGGGCCGGGCGCGG + Intergenic
950867591 3:16201469-16201491 GACGAATTTTCGGCCAGGCGCGG - Intronic
950922398 3:16707878-16707900 AATGGATTCCCGGCCGGGCGCGG + Intergenic
952371848 3:32730056-32730078 TATAAATTCTGGGCCGGGCGCGG - Intronic
954251271 3:49369311-49369333 AGTGAATACTCGGCCGGGTGTGG - Intronic
954855384 3:53639674-53639696 AATGAAATCTCAGCCGGGCGCGG - Intronic
954899557 3:54007184-54007206 GCTTAAAACTTGGCCGGGCGTGG - Intergenic
955983666 3:64551497-64551519 GAGGAGTTCTCGGCCGGGAGTGG - Intronic
956216579 3:66855483-66855505 GCTGAGCTCTCGGCCAGGCGCGG - Intergenic
957119663 3:76073579-76073601 GAAGAATACTCTGCCGGGCGCGG - Intronic
958955443 3:100461019-100461041 GCAGAAGTGACGGCCGGGCGCGG - Intergenic
959094179 3:101935095-101935117 GCTTAGATTTCGGCCGGGCGCGG - Intergenic
959449133 3:106478147-106478169 GGAGTATTCTGGGCCGGGCGTGG + Intergenic
959660671 3:108864489-108864511 TAAAAATTCTCGGCCGGGCGCGG + Intergenic
960336801 3:116427408-116427430 GCTGAGTCTTGGGCCGGGCGCGG - Intronic
960462450 3:117952619-117952641 TAAGAATTCTAGGCCGGGCGCGG - Intergenic
960666205 3:120111522-120111544 ACACACTTCTCGGCCGGGCGCGG + Intergenic
960850917 3:122052857-122052879 TCTGACTTTTTGGCCGGGCGCGG - Intergenic
961755598 3:129125384-129125406 GTTAAATTCTTGGCCGGGCGCGG - Intronic
961899541 3:130197540-130197562 GATAAAAGCTCGGCCGGGCGCGG + Intergenic
962288608 3:134109853-134109875 ATTGAATTCTTGGCTGGGCGCGG - Intronic
962349131 3:134644113-134644135 GCAGGAGGCTCGGCCGGGCGCGG - Intronic
962757921 3:138481654-138481676 GATGGGATCTCGGCCGGGCGTGG - Intronic
962785366 3:138763425-138763447 GCTAACTTCTGGGCCGGGCACGG - Intronic
963090985 3:141483844-141483866 ACTTTATTTTCGGCCGGGCGCGG + Intergenic
963892128 3:150647661-150647683 TGTGGAATCTCGGCCGGGCGCGG - Intergenic
964725536 3:159810333-159810355 GGTGAATTTGAGGCCGGGCGTGG - Intronic
965171586 3:165271641-165271663 GCTTATTTCTGGGCCGGGCACGG - Intergenic
965534432 3:169810772-169810794 GCTGCATTTCCGGCCGGGTGCGG + Intronic
965765692 3:172127946-172127968 GCTGTATCCTCGGCCGGGTGTGG - Intronic
965905629 3:173701947-173701969 GAAGAGTTTTCGGCCGGGCGCGG + Intronic
965970947 3:174555588-174555610 ACTGAATTTTTGGCCAGGCGCGG - Intronic
966288311 3:178323945-178323967 GCTGTATTTTTGGCAGGGCGTGG - Intergenic
967430702 3:189381853-189381875 ACTCAAATCTAGGCCGGGCGTGG - Intergenic
967490131 3:190080690-190080712 GCTCAAATCTCAGCTGGGCGCGG - Intronic
968172863 3:196524372-196524394 GATGAGTTTTAGGCCGGGCGTGG - Intergenic
968185856 3:196633166-196633188 AAGGACTTCTCGGCCGGGCGCGG + Intergenic
969743831 4:9054193-9054215 GATAAAAGCTCGGCCGGGCGCGG - Intergenic
969922326 4:10552144-10552166 TTATAATTCTCGGCCGGGCGTGG - Intronic
969933263 4:10654810-10654832 AATGATTTCTCGGCCAGGCGTGG + Intronic
971839950 4:31837990-31838012 AAGGAATTCTCTGCCGGGCGCGG - Intergenic
972148029 4:36053292-36053314 ACTGCATGCTGGGCCGGGCGCGG - Intronic
972583218 4:40413690-40413712 GATGAATTCTGGGTCAGGCGCGG + Intergenic
972714194 4:41629606-41629628 CCTGAATTCTCTGCTGGGCCAGG - Intronic
973815572 4:54616259-54616281 GCTTATTTACCGGCCGGGCGCGG + Intergenic
974025277 4:56728221-56728243 GATGAGAACTCGGCCGGGCGCGG + Intergenic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
974911090 4:68120676-68120698 AAAGATTTCTCGGCCGGGCGCGG - Intronic
975131605 4:70837939-70837961 GCTTAATGTTAGGCCGGGCGCGG + Intronic
975327801 4:73079822-73079844 GCTTAAATATTGGCCGGGCGCGG + Intronic
975783008 4:77859261-77859283 AATGGATTCTCGGCCGGGCGTGG - Intergenic
976995311 4:91424305-91424327 GCTGAGTTCTTGGCCGGGCGCGG - Intronic
977429162 4:96909556-96909578 TATGAATTATTGGCCGGGCGCGG - Intergenic
978733267 4:112056226-112056248 AATGAATTCTGGGCCAGGCGTGG - Intergenic
978978321 4:114909368-114909390 GCTAAATTATTGGCCGGGCGCGG + Intronic
979452442 4:120888080-120888102 GATAAAATGTCGGCCGGGCGCGG - Intronic
979630109 4:122891328-122891350 GATAAATGTTCGGCCGGGCGCGG - Intronic
979687309 4:123524972-123524994 GTTGAATTCCAGGCTGGGCGCGG - Intergenic
980452128 4:132987679-132987701 TCTGGCTTCTGGGCCGGGCGCGG - Intergenic
982037910 4:151364652-151364674 GATGAATTATAGGCCAGGCGCGG + Intergenic
983026779 4:162747384-162747406 ACTCAATAGTCGGCCGGGCGTGG - Intergenic
983378419 4:166959322-166959344 ATTGAATTCTCGGCCAGGCGTGG + Intronic
984500359 4:180550801-180550823 ACATAAATCTCGGCCGGGCGCGG + Intergenic
984599589 4:181710837-181710859 GATGGAGTCTCGGCCGGGCGCGG - Intergenic
985032719 4:185806746-185806768 ACAGGATTCTAGGCCGGGCGCGG - Intronic
985103834 4:186483039-186483061 GCCAAATTCTAGGCCGGGAGCGG + Intronic
985226650 4:187768411-187768433 GCTTGAGTCTAGGCCGGGCGTGG - Intergenic
985259314 4:188100430-188100452 GGTGAATTCTAGGCCGGGCGCGG + Intronic
985270608 4:188191396-188191418 GCTGCTGTCTAGGCCGGGCGCGG + Intergenic
985272130 4:188203614-188203636 GCAGAATTATGGGCCGGGCGCGG - Intergenic
985293684 4:188412152-188412174 GCTGATTCCTGGGCCGCGCGGGG + Intergenic
985857081 5:2436831-2436853 TCTGAAATTTAGGCCGGGCGCGG - Intergenic
986119663 5:4821080-4821102 AATGATTTCTTGGCCGGGCGTGG - Intergenic
986160165 5:5220446-5220468 GTTAAATTATTGGCCGGGCGCGG - Intronic
986315160 5:6582274-6582296 GCTGACTCCTGGGCCGGGAGGGG + Intergenic
987420978 5:17719605-17719627 AGTGACTTCTCGGCCGGGCACGG - Intergenic
987581772 5:19803829-19803851 GATAAATCCTAGGCCGGGCGCGG + Intronic
988164946 5:27575569-27575591 TCTGACATCTTGGCCGGGCGCGG + Intergenic
988556428 5:32240108-32240130 AATGAATTGTAGGCCGGGCGCGG + Intronic
988611577 5:32731949-32731971 AATCCATTCTCGGCCGGGCGCGG + Intronic
988801725 5:34702102-34702124 GTTGAACTCTTGGGCGGGCGTGG - Intronic
989079238 5:37599599-37599621 GGTGAATTTGGGGCCGGGCGTGG + Intronic
989187022 5:38635726-38635748 GCTGACTTCCAGGCCGGGCACGG - Intergenic
990181320 5:53163579-53163601 ACAGTATCCTCGGCCGGGCGCGG - Intergenic
990388909 5:55298738-55298760 GCTAAATATTAGGCCGGGCGCGG + Intronic
991957660 5:72011944-72011966 GAGGTGTTCTCGGCCGGGCGCGG - Intergenic
992146506 5:73855439-73855461 GTTGAAGTATCGGCTGGGCGTGG + Intronic
992395420 5:76364951-76364973 GCTTGATTCTTGGCCAGGCGTGG - Intergenic
992723235 5:79581012-79581034 TCCAAATTCTCGGCCGGGCGTGG + Intergenic
992821473 5:80501308-80501330 GGTGGTCTCTCGGCCGGGCGCGG - Intronic
993364007 5:87013126-87013148 AATGAATACTAGGCCGGGCGCGG - Intergenic
993376779 5:87157776-87157798 AATGACTTTTCGGCCGGGCGCGG - Intergenic
993722887 5:91338823-91338845 AATTTATTCTCGGCCGGGCGCGG - Intergenic
994060422 5:95470266-95470288 ATTGAATTGTTGGCCGGGCGCGG - Intronic
994067227 5:95556717-95556739 TTTGCATTCACGGCCGGGCGCGG + Intronic
994195816 5:96922006-96922028 ACTGTTTTCTAGGCCGGGCGCGG + Intronic
995043971 5:107622729-107622751 GTTGAATACTCGGCCGGGCGCGG + Intronic
996121588 5:119679758-119679780 AGAGACTTCTCGGCCGGGCGCGG - Intergenic
996649824 5:125861438-125861460 TGTCAGTTCTCGGCCGGGCGTGG - Intergenic
997975431 5:138439156-138439178 GCTGCATCCTCGGCCGGGCCGGG + Exonic
998079994 5:139266893-139266915 GCTGATTTGGAGGCCGGGCGCGG - Intronic
998084060 5:139301610-139301632 GCTCCATTCTGGGCTGGGCGCGG - Intronic
999258942 5:150226034-150226056 ATTGAATTCTCGGCCGGGTGCGG - Intronic
999412022 5:151358681-151358703 TGTTGATTCTCGGCCGGGCGCGG + Intergenic
999579350 5:153018625-153018647 GTAAAATTGTCGGCCGGGCGCGG + Intergenic
1000026054 5:157360231-157360253 GCTGAATTCTGGGCTATGCGGGG - Intronic
1000386859 5:160682747-160682769 GATGCTTTCTCGGCCGGGCGCGG + Intronic
1000405298 5:160881520-160881542 GCCAAAATTTCGGCCGGGCGTGG + Intergenic
1000685015 5:164237982-164238004 GCTGTAAACTCGGCCGGGCGAGG + Intergenic
1001478136 5:172065513-172065535 TATGCATTCTCGGCCAGGCGCGG - Intronic
1002592802 5:180302937-180302959 GATGAATTCCAGGCCGGGCGTGG + Intronic
1002722262 5:181269315-181269337 GATGGATTCGTGGCCGGGCGCGG - Intergenic
1002785042 6:393606-393628 GCTGAAGGCCCGGCCGGGCCCGG + Intronic
1003062327 6:2873465-2873487 GCTGAGTGCTGGGCAGGGCGGGG - Intergenic
1003343396 6:5243061-5243083 GCAGAAATCCTGGCCGGGCGCGG - Intronic
1003997630 6:11558902-11558924 GCTGACTTCTGGGCTGGGCTTGG - Intronic
1004223416 6:13766195-13766217 GCTGAATTCACGGCCATGAGGGG - Intergenic
1004227937 6:13804482-13804504 GTAGAAGTCTTGGCCGGGCGCGG + Intronic
1004961890 6:20799340-20799362 GCTCAGTTCTAGGCCGGGCACGG - Intronic
1005020260 6:21411369-21411391 GTTACATTTTCGGCCGGGCGCGG + Intergenic
1005631418 6:27711698-27711720 GCTAATTTCTGGGCCGGGCGTGG + Intergenic
1006372496 6:33653975-33653997 GATGCACTCTCTGCCGGGCGTGG + Intronic
1006484578 6:34328179-34328201 GCTGGATTCTTGGCCGGGCGTGG - Intronic
1006702625 6:35988199-35988221 GCTGAATTCGGGGCCGGGCACGG - Intronic
1006859904 6:37164674-37164696 CCAGCATTTTCGGCCGGGCGCGG + Intergenic
1007945736 6:45825334-45825356 GTTTAATTCTTGGCCTGGCGCGG + Intergenic
1009328226 6:62381160-62381182 AAAGAATTCTTGGCCGGGCGCGG + Intergenic
1009772788 6:68164374-68164396 GATGAATGATAGGCCGGGCGCGG - Intergenic
1010229933 6:73525149-73525171 TTTGGATTCTCGGCTGGGCGTGG - Intergenic
1011059090 6:83242824-83242846 GCTGAATTGTTGGCCGGCAGTGG + Intronic
1011335880 6:86259278-86259300 GCTGGAATCTGGGCAGGGCGAGG + Intergenic
1012975463 6:105777118-105777140 GCAAGATTCTCAGCCGGGCGTGG + Intergenic
1012996482 6:105980572-105980594 AATGAATTTTAGGCCGGGCGCGG - Intergenic
1013306826 6:108855539-108855561 GTTGAAAACTTGGCCGGGCGAGG - Intronic
1013335293 6:109152471-109152493 GATAAAGTCTAGGCCGGGCGTGG - Intronic
1013550444 6:111202596-111202618 GATGAATTCCTGGCCGAGCGCGG + Intronic
1014040364 6:116818242-116818264 AAAGAATTTTCGGCCGGGCGCGG + Intronic
1014380514 6:120735344-120735366 ACTGAGTCCTGGGCCGGGCGCGG + Intergenic
1015102474 6:129497523-129497545 GCTAAATTCTGGGCCAGGCGTGG - Intronic
1015606699 6:134963710-134963732 ATAGAACTCTCGGCCGGGCGCGG - Exonic
1015656244 6:135522392-135522414 GCTTTATTCTTGGCCAGGCGTGG - Intergenic
1015970135 6:138735297-138735319 TCAGCATACTCGGCCGGGCGCGG + Intergenic
1017153071 6:151298501-151298523 AATGAATTCTTGGCCAGGCGAGG + Intronic
1017747108 6:157456855-157456877 ACTGAGTTGTGGGCCGGGCGTGG + Intronic
1017795117 6:157836879-157836901 TGTGTGTTCTCGGCCGGGCGCGG - Intronic
1017906720 6:158761596-158761618 TGTGCATTCTGGGCCGGGCGTGG - Intronic
1018201634 6:161400602-161400624 GTTTAATTTTCGGCCGAGCGTGG - Intronic
1018753596 6:166829299-166829321 AATGAATTATCGGCCGGGCGCGG + Intronic
1018933619 6:168258969-168258991 CTTGACTTCTCGGCCGGGCGCGG - Intergenic
1019094986 6:169572248-169572270 AAAGAATTCTGGGCCGGGCGTGG + Intronic
1019104419 6:169656900-169656922 GCTGACTCCTCGGCTGGGAGTGG - Intronic
1019375557 7:689969-689991 ACTGTGTTCTCGGCCAGGCGCGG - Intronic
1019392406 7:795758-795780 GGTAAATTCATGGCCGGGCGCGG + Intergenic
1019475710 7:1243076-1243098 GCTCAGGGCTCGGCCGGGCGAGG + Intergenic
1019699847 7:2469254-2469276 GCAGAGGTTTCGGCCGGGCGCGG + Intergenic
1020188643 7:5977343-5977365 GCAGTATTCTTGGCCGGGCATGG - Intronic
1020292716 7:6734531-6734553 TGTTATTTCTCGGCCGGGCGCGG - Intergenic
1020294272 7:6747428-6747450 GCAGTATTCTTGGCCGGGCATGG + Intergenic
1020662831 7:11002732-11002754 TCTTAATTTTTGGCCGGGCGCGG - Intronic
1020843178 7:13247525-13247547 TGTCAATTCTCGGCCGGGTGCGG + Intergenic
1021315068 7:19138222-19138244 CCTGAAATATCGGCCGGGCATGG - Intergenic
1021559583 7:21956536-21956558 ACAGAACTCTTGGCCGGGCGCGG - Intergenic
1022540955 7:31135059-31135081 ACTGAATTCTTGGTTGGGCGCGG + Intergenic
1022851236 7:34264376-34264398 GGTGTTCTCTCGGCCGGGCGCGG + Intergenic
1023121334 7:36911925-36911947 GCTGTATTCTCAGCTGGGCCTGG - Intronic
1023356409 7:39371467-39371489 GAACCATTCTCGGCCGGGCGTGG - Intronic
1023829957 7:44033367-44033389 ATGGAATTCTAGGCCGGGCGTGG + Intergenic
1025145706 7:56500821-56500843 ATTGAAGTATCGGCCGGGCGCGG - Intergenic
1025291312 7:57727032-57727054 TATGGATTCTCGGCCGGGCGCGG - Intergenic
1025792206 7:64699776-64699798 TGTACATTCTCGGCCGGGCGTGG + Intronic
1026772099 7:73208945-73208967 ACTGATTCCTTGGCCGGGCGCGG + Intergenic
1026826829 7:73587706-73587728 CCAGAATTCTCGGCCAGGCTCGG - Intergenic
1026840331 7:73667419-73667441 GCTGACTTGCTGGCCGGGCGCGG - Intergenic
1027012968 7:74762335-74762357 ACTGATTCCTTGGCCGGGCGTGG + Intergenic
1027075073 7:75183708-75183730 ACTGATTCCTTGGCCGGGCGCGG - Intergenic
1027194644 7:76021369-76021391 ACTATATTCTTGGCCGGGCGCGG - Intronic
1027611658 7:80368840-80368862 GATTCATTCACGGCCGGGCGCGG + Intergenic
1027651337 7:80872511-80872533 GCTGAATTCTCGGCCGGGCGTGG + Intronic
1027673134 7:81127004-81127026 GAGGAACTCTCGGCCAGGCGTGG - Intergenic
1028174874 7:87643815-87643837 TGCGAATTCTTGGCCGGGCGTGG - Intronic
1028522686 7:91749087-91749109 TAAGAATTCTCGGCCGGGCGCGG - Intronic
1028852110 7:95549585-95549607 AATGGAGTCTCGGCCGGGCGCGG - Intergenic
1029069502 7:97883695-97883717 GATAAAAGCTCGGCCGGGCGCGG + Intergenic
1029209222 7:98891826-98891848 GCTACATGCTGGGCCGGGCGCGG - Intronic
1029740271 7:102487639-102487661 ATGGAATTCTAGGCCGGGCGTGG + Intronic
1029758267 7:102586813-102586835 ATGGAATTCTAGGCCGGGCGTGG + Intronic
1029776205 7:102685891-102685913 ATGGAATTCTAGGCCGGGCGTGG + Intergenic
1030031755 7:105376285-105376307 AATGAATTTTTGGCCGGGCGTGG - Intronic
1030291901 7:107881035-107881057 GATTTACTCTCGGCCGGGCGCGG + Intergenic
1030650289 7:112110032-112110054 GATGATTTTACGGCCGGGCGCGG - Intronic
1031337561 7:120554696-120554718 TGTAAATTCTCGGCCAGGCGCGG - Intronic
1032649527 7:133862199-133862221 GCTTTATTCTAGGTCGGGCGTGG + Intronic
1033960176 7:146904759-146904781 GATGAATTCTCGGCCGGACGCGG - Intronic
1034167781 7:149039008-149039030 GCTGAAGTTCCGGCTGGGCGTGG - Intergenic
1034171481 7:149066201-149066223 ACTGTGTTATCGGCCGGGCGCGG + Intergenic
1034180323 7:149132482-149132504 GCTGTTCTCTAGGCCGGGCGGGG - Intronic
1034651109 7:152690980-152691002 ACTTAATTCTCGGCTGGGCTGGG + Intergenic
1035850459 8:2914705-2914727 GCTGAATTCCCTGCCTGGCACGG - Intergenic
1035916003 8:3623683-3623705 GCTGACTCCAGGGCCGGGCGTGG + Intronic
1036068923 8:5418638-5418660 AAGGTATTCTCGGCCGGGCGCGG + Intergenic
1036249041 8:7145968-7145990 GATAAAAGCTCGGCCGGGCGCGG - Intergenic
1036885200 8:12547006-12547028 GATAAAAGCTCGGCCGGGCGCGG + Intergenic
1037781430 8:21871893-21871915 GATAACTTCTCGGCCAGGCGCGG + Intergenic
1038716723 8:29997831-29997853 CCTGAACTCTCGGCAGGGTGTGG - Intergenic
1038905974 8:31903437-31903459 GTTGAAGGCTCGGCCGGGCGCGG - Intronic
1040017040 8:42708174-42708196 TGTGGATTCTGGGCCGGGCGTGG + Intronic
1041064049 8:54064122-54064144 TAAGAATTCTGGGCCGGGCGGGG + Intronic
1041633169 8:60111043-60111065 GCATAATTATAGGCCGGGCGTGG - Intergenic
1041712538 8:60907444-60907466 AGTGACTTCTTGGCCGGGCGTGG - Intergenic
1042045797 8:64650355-64650377 ACTTAATTCTTGGCTGGGCGTGG + Intronic
1044069346 8:87737695-87737717 AATTATTTCTCGGCCGGGCGCGG - Intergenic
1044323555 8:90833870-90833892 TCAGAATTCTCAGCCAGGCGTGG + Intronic
1044664931 8:94625060-94625082 ACTCAATTCACTGCCGGGCGTGG + Intergenic
1045300406 8:100905909-100905931 GTTGTATTTTTGGCCGGGCGTGG - Intergenic
1046170678 8:110501295-110501317 GAAAATTTCTCGGCCGGGCGCGG + Intergenic
1046374671 8:113360861-113360883 ACTGAAGTCACGGCCGGGCGCGG - Intronic
1046503403 8:115107984-115108006 GCTGAATTTTAGGCCAGGCACGG + Intergenic
1047239676 8:123074308-123074330 ACTGATTTGTCGGCCAGGCGCGG - Intronic
1047886311 8:129253855-129253877 GCTGAATTCTGGACCTGGCTTGG - Intergenic
1047952154 8:129943887-129943909 GATGGAGTCTCGGCGGGGCGCGG - Intronic
1048678955 8:136817295-136817317 AATGTTTTCTCGGCCGGGCGCGG + Intergenic
1049759303 8:144324775-144324797 TCTCAATTCCCGGCCGGGCGCGG + Intronic
1049827898 8:144681976-144681998 TCTTACTTCTCGGCCGGGTGCGG + Intergenic
1050083553 9:1940695-1940717 AATAAACTCTCGGCCGGGCGCGG + Intergenic
1051368848 9:16340987-16341009 TCTCCATTCTGGGCCGGGCGCGG - Intergenic
1051823889 9:21197678-21197700 AATGAAATGTCGGCCGGGCGCGG + Intergenic
1052288776 9:26818836-26818858 GATGTATTCTGGGCCGGGCATGG - Intergenic
1052426708 9:28314222-28314244 AATCAATTCTCGGCCGGGCGCGG - Intronic
1052962897 9:34316059-34316081 GTTCCATTATCGGCCGGGCGTGG + Intronic
1053400723 9:37818282-37818304 GTTGAAATCTTGGCCGGGTGCGG - Intronic
1054818644 9:69499697-69499719 GCTGAATTCAGGGCAGGGAGAGG + Intronic
1055060363 9:72062374-72062396 AATGTATTCTTGGCCGGGCGCGG - Intronic
1058308827 9:103475389-103475411 ACTGAATTCAGGGCCGGGCACGG - Intergenic
1058339598 9:103878219-103878241 TCAGAATTATTGGCCGGGCGCGG - Intergenic
1058368986 9:104242501-104242523 GATAAAATATCGGCCGGGCGCGG - Intergenic
1058728548 9:107826805-107826827 GATGAAATCTGGGCCGGGCGCGG - Intergenic
1058904244 9:109468654-109468676 ACTGTATTCACAGCCGGGCGCGG - Intronic
1059993083 9:119883538-119883560 TCTGCATTCTTGGCCGGGCATGG - Intergenic
1060180510 9:121530384-121530406 GATGGAGTCTCGGCCGGGCATGG + Intergenic
1060633040 9:125177082-125177104 AGAGAATTCCCGGCCGGGCGCGG + Intronic
1060922578 9:127432438-127432460 AATGAATTTTAGGCCGGGCGTGG - Intronic
1061182048 9:129030098-129030120 GGTGAAACCTAGGCCGGGCGTGG - Intergenic
1061547715 9:131314403-131314425 GGTGAAACCCCGGCCGGGCGCGG - Intergenic
1061891261 9:133621703-133621725 ACAGAAATCTTGGCCGGGCGCGG - Intergenic
1062239593 9:135528811-135528833 ACAGAATTCTCGGCTGGACGTGG + Intergenic
1185476407 X:418186-418208 TACCAATTCTCGGCCGGGCGCGG - Intergenic
1185563369 X:1077743-1077765 GCTTATTTCTCGGCCGGTCGCGG + Intergenic
1186300760 X:8197681-8197703 ATTGAACTCTGGGCCGGGCGCGG + Intergenic
1186551476 X:10510540-10510562 GCTGAAACCCAGGCCGGGCGTGG + Intronic
1187529292 X:20081938-20081960 GCTCAGATCTGGGCCGGGCGCGG - Intronic
1187542253 X:20208423-20208445 GTTGCATCTTCGGCCGGGCGTGG + Intronic
1188563690 X:31499781-31499803 ACTGAATTCCCGGCTGGGTGTGG - Intronic
1189325967 X:40111001-40111023 GGTTGATTCTCGGCCGGGCGTGG - Intronic
1189921802 X:45909664-45909686 GAGTAATTTTCGGCCGGGCGCGG + Intergenic
1192176666 X:68890535-68890557 GGTAACTCCTCGGCCGGGCGTGG + Intergenic
1192783215 X:74314768-74314790 ACACAATTGTCGGCCGGGCGCGG - Intergenic
1193426905 X:81350292-81350314 ACTGTAATGTCGGCCGGGCGCGG - Intergenic
1194548175 X:95263882-95263904 CTTAAAGTCTCGGCCGGGCGAGG - Intergenic
1195052347 X:101108484-101108506 GCTGAATTTGGGGCCGAGCGTGG - Intronic
1195370754 X:104169856-104169878 TTTGAATACTGGGCCGGGCGCGG - Intronic
1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG + Intronic
1195933832 X:110106662-110106684 GCTGGATTCTGGGCTGGGCGTGG - Intronic
1196854882 X:119973444-119973466 GCTTAATTGTGGGCCGGGCGGGG - Intergenic
1197215087 X:123859960-123859982 GCTGACCTCCCGGCCGGGGGTGG + Intronic
1197791148 X:130255428-130255450 AATGATTTTTCGGCCGGGCGCGG - Intronic
1198082611 X:133253333-133253355 GTAGCATTCTGGGCCGGGCGTGG + Intergenic
1198522699 X:137468949-137468971 ACTGGATTATCGGCCGGGTGAGG - Intergenic
1198582880 X:138086093-138086115 ACTACATTCTTGGCCGGGCGTGG - Intergenic
1199591888 X:149475413-149475435 GTTGAACTTTCGGCCGGGTGTGG - Intergenic
1202193938 Y:22276204-22276226 GCTGAATATTCAGCCGGGCGTGG + Intergenic