ID: 1027652337

View in Genome Browser
Species Human (GRCh38)
Location 7:80884586-80884608
Sequence AGGGAAACTTCAGCTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027652333_1027652337 6 Left 1027652333 7:80884557-80884579 CCATCAGTCTAAACAGAAGAGGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1027652337 7:80884586-80884608 AGGGAAACTTCAGCTTTTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027652337 Original CRISPR AGGGAAACTTCAGCTTTTGA GGG Intronic
900767705 1:4516204-4516226 AGGGAAACTTTATCTGTGGATGG + Intergenic
902537633 1:17130270-17130292 ACGGAAACTTCAGGCTTGGATGG + Intergenic
902932051 1:19738352-19738374 AGGGAAACTTCGTCTTTGGCTGG - Intronic
904767384 1:32860947-32860969 AGGGAAACCTCAGGGTCTGAGGG - Intergenic
905711900 1:40112045-40112067 GGGAATACTTCAGCTTTTGCTGG - Intergenic
908641886 1:66233088-66233110 AGGGAAACTTTTGGGTTTGATGG - Intronic
909127664 1:71694936-71694958 AGGGAATCTTCAGGTTATCAGGG + Intronic
909662659 1:78101121-78101143 AGGGGAACATCAGCATTTAAGGG + Intronic
909792369 1:79695217-79695239 AGAGAAACTTCAAATTTTGGAGG + Intergenic
910021903 1:82601713-82601735 AAAGAAATTTCAGATTTTGAAGG + Intergenic
911189551 1:94933918-94933940 AGGATACCTTCAGATTTTGAGGG - Intergenic
911902216 1:103521170-103521192 TGGGAAACTCCAGCCTTTGGAGG + Intergenic
916011195 1:160707484-160707506 AGGGACACTTCATCCTCTGAGGG + Intronic
917131585 1:171748341-171748363 AGGGAGACTCCATCTTTAGACGG + Intergenic
918445026 1:184608972-184608994 AAGAAGACTTCAGCTATTGATGG - Intronic
918617849 1:186568084-186568106 AGGGAAACTGCAGCATTAGTAGG - Intergenic
920253886 1:204640904-204640926 AGGAAAACAGCAGCATTTGAGGG + Intronic
920620243 1:207538606-207538628 AGGGAAACTTCTGTGTTTCAGGG + Intronic
920622025 1:207557163-207557185 AGGGAAACTTCTGTGTTTCAGGG + Intronic
920623645 1:207574238-207574260 AGGGAAACTTCTGTGTTTCAGGG + Intronic
921251227 1:213300377-213300399 GGGTAAACTCCAGCTTTTAATGG + Intergenic
921409182 1:214816090-214816112 GGGGAAACTTCAGCCTTTAAAGG - Intergenic
1063078914 10:2746125-2746147 AGAGAAAGATCAGCTATTGATGG - Intergenic
1063223746 10:3994824-3994846 GGGGAAACTTTACCTTTAGACGG - Intergenic
1064782469 10:18857499-18857521 AGGGAAACTCCTGCTTTTTCTGG + Intergenic
1065926308 10:30436215-30436237 AGAGAAAGTTCAGATTGTGAAGG - Intronic
1066221963 10:33344000-33344022 AGGAAAACTTCATATTTTAAAGG - Intergenic
1068030016 10:51694727-51694749 AGGGAAAATTCAGGATGTGAGGG + Intronic
1071551395 10:86568896-86568918 TGGGAAACTTCAGGATTTAAGGG - Intergenic
1071785226 10:88892160-88892182 AGGGAAAGTTCAGCTGATCAGGG + Intronic
1074296907 10:112198219-112198241 ATGGAACCTTCAGACTTTGAGGG - Intronic
1076870161 10:133189071-133189093 AGGGAATCTTCAGCATTGCACGG + Intronic
1078005567 11:7529859-7529881 AGGAAACCTTCAGCTCTGGAAGG + Intronic
1078724485 11:13917443-13917465 TTGGGAACTTCAGCTTTTAAAGG + Intergenic
1079921672 11:26440971-26440993 AGGGGGACTTCTGCTTTTGGAGG + Intronic
1086269711 11:85047115-85047137 AAGGAAATTTCAGATTTGGAGGG - Intronic
1087834702 11:102861540-102861562 AGGGAATTTTCTTCTTTTGAGGG + Intergenic
1090976260 11:131683114-131683136 AGGGAAGCTTCGGTTTTAGAGGG - Intronic
1091863636 12:3810212-3810234 AGAGAAAATTCAGCATTAGAAGG + Exonic
1097125227 12:56769081-56769103 AGGGCAGTTTCAGCTTTTCAAGG + Intronic
1098105798 12:67068747-67068769 GGGGAAACTCCAGCTTCTGCAGG - Intergenic
1100602237 12:96121750-96121772 GGGGAAAATTCAGCTGTTGTGGG + Intergenic
1102834588 12:116042901-116042923 ACTGAGACTTCAGCTCTTGAGGG - Intronic
1102993992 12:117334268-117334290 AAGGAAACTTGATCTTTGGAAGG + Intronic
1104241759 12:126996886-126996908 AGGGGATCTTCAGCTTTTAGGGG - Intergenic
1106695233 13:32165778-32165800 AGGTAAGCTTCAGATTCTGATGG - Intronic
1109151947 13:58858070-58858092 AGAGAAAACTCAGCTTGTGATGG + Intergenic
1109855744 13:68125506-68125528 GTGGAAACTCCAGCTTTTAAAGG + Intergenic
1111359134 13:87151235-87151257 AGGGAAAATATTGCTTTTGAAGG - Intergenic
1111553674 13:89850970-89850992 AGAGAAAATTCTGCTTTTAAAGG + Intergenic
1111573353 13:90117027-90117049 AGGTAATTTTCAGCTTTTTAGGG - Intergenic
1112548581 13:100396931-100396953 AGGGAAACTGCAGGTTTATATGG - Intronic
1117523785 14:56577350-56577372 AGGAATACTTCAGCATTTGGGGG + Intronic
1117558813 14:56914222-56914244 TGGGAAAAATCAGCTTCTGATGG + Intergenic
1120003014 14:79324949-79324971 AGGGCAACTGGAGCTTTTAAAGG - Intronic
1120090521 14:80327305-80327327 AGGCAGTCTTCAGATTTTGAAGG - Intronic
1123538459 15:21262142-21262164 ACGGACAGTTCAGCTCTTGATGG + Intergenic
1123795060 15:23762890-23762912 ACCGAAACTTCAGCTATTGTGGG - Intergenic
1123956678 15:25342955-25342977 AGGGACACTTCTGCTTTTGAAGG - Intronic
1124095481 15:26644848-26644870 AGGGACACATCAGCATGTGATGG + Intronic
1128028155 15:64456852-64456874 ATGGAAACTTCTCCTTTTCATGG + Intergenic
1131147405 15:90023096-90023118 AGGGAAACTGAGGCTTATGAAGG + Intronic
1134739529 16:16530186-16530208 GGAGAAACTTCAGCTTTACAGGG + Intergenic
1134927971 16:18181966-18181988 GGAGAAACTTCAGCTTTACAGGG - Intergenic
1135717423 16:24783642-24783664 AGGCAAACTTAAGATTTGGAAGG - Intronic
1135967745 16:27050046-27050068 AATGAAACCTCAGCTTTGGAGGG + Intergenic
1136613317 16:31380348-31380370 AGGGCAACCTCAGCTTTGGCTGG + Exonic
1140264576 16:73409217-73409239 AGGGAACCCTAAGCTTTTAAAGG - Intergenic
1140932907 16:79644212-79644234 AGGGAAACTCCAGAGTTTGGGGG - Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1146512837 17:33465237-33465259 TAGGAAACTTCAGCATTTGGAGG - Intronic
1146665394 17:34699187-34699209 AGGGAGAGTTGAGTTTTTGAGGG + Intergenic
1147578969 17:41617972-41617994 AGGGAGACGTCAGCCTCTGATGG + Intergenic
1148426653 17:47603705-47603727 AGGGAAACTTGAAATTGTGAGGG - Intronic
1149061805 17:52431393-52431415 AGGGAAACTTGAGATTTGGGAGG - Intergenic
1149628266 17:58096030-58096052 AGGGAAACCTCAGCTTTCAACGG + Intergenic
1153597515 18:6742687-6742709 TGGGAGACTTCAGCATTTGGGGG + Intronic
1155296335 18:24387878-24387900 AGGGAAACTGCAGCTTCTGGTGG - Intronic
1155440670 18:25858815-25858837 AGGGCAACTTCAAGTCTTGATGG - Intergenic
1156750998 18:40454833-40454855 TGGGAAACACCAGCTTTTAAAGG + Intergenic
1156972050 18:43168770-43168792 AAGGAAACTTGAGCTATTTATGG + Intergenic
1164291556 19:23873788-23873810 AATGAAACTTTAGCTTTTGGTGG - Intergenic
1165365294 19:35361656-35361678 AGGGAGACTCCAGCTCTTCATGG - Intergenic
1165399063 19:35586140-35586162 TGCGAAGCTTCAGCCTTTGATGG + Intergenic
1166919149 19:46216865-46216887 GGGAGAACTTCAGCCTTTGATGG - Intergenic
1168010523 19:53527390-53527412 AGGGAAATTTCAGTTGTAGATGG + Intronic
1168511052 19:56973885-56973907 ATGGAAACTGCAGCTTGTGTGGG - Intergenic
925557937 2:5152774-5152796 AGGGAAGCTGCAGGTTTTCAGGG + Intergenic
926831353 2:16965677-16965699 ACTGAAGCATCAGCTTTTGAGGG - Intergenic
927289771 2:21393991-21394013 AGGGCAAATTCATTTTTTGAAGG + Intergenic
928337365 2:30409156-30409178 AGGGACAGTTCAGCTATTAATGG - Intergenic
931039164 2:58277730-58277752 AGTAAAACTACAGCTTTTTAAGG - Intergenic
931171736 2:59810545-59810567 AGTAAAACTTCAGCCTTTGTGGG - Intergenic
931312923 2:61099709-61099731 AGGGAAACTACAGCTATGGCTGG + Intronic
931464769 2:62476462-62476484 AGGCACTCTTCAGCTTATGATGG + Intergenic
932428912 2:71661828-71661850 TGGGGAAATGCAGCTTTTGAAGG + Intronic
932903087 2:75722768-75722790 AGGGAAATTTAAGCTATGGAAGG - Intergenic
933002911 2:76949540-76949562 AGAGAAATTTCAGCTGTTGAAGG + Intronic
933117218 2:78489552-78489574 AGAGAAAATTCAGCTTTTAAAGG - Intergenic
933126484 2:78614319-78614341 AGAGAAACTACAGCTCTTAATGG + Intergenic
935283619 2:101543256-101543278 AGAGAAACTTCAGAACTTGATGG - Intergenic
935957153 2:108388600-108388622 AGTGAAAGTTCAGCCATTGAAGG - Intergenic
938831554 2:135054674-135054696 AGGGAAACATCAGTTTTGAATGG + Intronic
938841143 2:135165167-135165189 AGGAAAACTTCAGATTTTTAGGG + Intronic
939290723 2:140191777-140191799 AAGGAGACTTCTGCTGTTGAAGG - Intergenic
940414670 2:153405714-153405736 AGAGAAACATAAGATTTTGAAGG + Intergenic
940762898 2:157757333-157757355 TGGGAAATTTCAGCTTTTTTTGG - Intronic
941230358 2:162904272-162904294 AGGAAAACTACAGCTTCTGAAGG + Intergenic
941449378 2:165641368-165641390 AGGGTAACTTCTTCTGTTGAAGG + Intronic
941496662 2:166213698-166213720 AAGAAAATTACAGCTTTTGAAGG + Intronic
942910077 2:181232655-181232677 AGGTAAAATGCTGCTTTTGAAGG + Intergenic
942911831 2:181253067-181253089 AGAGTAACTTGAGGTTTTGAGGG + Intergenic
943755462 2:191552481-191552503 ATGGAAACTACTTCTTTTGATGG + Intergenic
943954108 2:194163710-194163732 AGGGAAACTAGAGCATTCGAAGG + Intergenic
944887163 2:204074972-204074994 AGTGTTACTTCAACTTTTGAGGG - Intergenic
947140763 2:227017563-227017585 TAGGAAGCTTCAGCCTTTGAGGG + Intronic
947286511 2:228522698-228522720 AGGGAAACTTCATTTTTGAATGG - Intergenic
947904987 2:233754815-233754837 AGTGAATTTCCAGCTTTTGAGGG - Intronic
1171317483 20:24207771-24207793 GAGCAAACTTCAGATTTTGAAGG + Intergenic
1172420783 20:34815670-34815692 AGAGATACATCAGCTTTTCAGGG - Intronic
1173312136 20:41906098-41906120 AGGGTAACTTCAGCAGTTTAGGG + Intergenic
1173690029 20:44953457-44953479 TGAGAAACTCCAGCATTTGAGGG - Intronic
1175135752 20:56822464-56822486 AGGGAAACTGCACCTGTTCAAGG + Intergenic
1175657424 20:60783638-60783660 AGGGAAACATTGGGTTTTGAGGG - Intergenic
1176153117 20:63603391-63603413 AGGGAAACCTAAGGTTTTAAAGG + Intronic
1179284709 21:39967483-39967505 TGGGAAACTTCAGTCTTTTAAGG + Intergenic
1180921673 22:19524551-19524573 AGGGAAACAACGGCTCTTGAGGG + Intronic
1183503086 22:38192927-38192949 AGGGAAATCTGAGCTTTAGAAGG + Intronic
1185201732 22:49510785-49510807 AGTGAATGTTCAGCTTTAGAAGG + Intronic
949569283 3:5276308-5276330 AGAGAAAAATCAGCTTTTGGAGG + Intergenic
949741184 3:7236474-7236496 GGAAAAACTTCAGCTTTTGATGG - Intronic
952492227 3:33883782-33883804 AGGGATGCTTCAGCTCTTGGCGG - Intergenic
954608392 3:51931137-51931159 AAGGAAACTTCATCTCTTGATGG - Intergenic
955703310 3:61703647-61703669 AGTGAAACTTCACCTTTTCTTGG + Intronic
957479019 3:80767579-80767601 AGGAAAACTACAGCTGATGAAGG + Intergenic
958476341 3:94588545-94588567 AAGGTAAGTTCATCTTTTGAAGG + Intergenic
961480742 3:127178228-127178250 AGGGCAACTGTAGCATTTGATGG - Intergenic
964722628 3:159782285-159782307 AGGGAAACTGAAGCTTATGGTGG + Intronic
966068318 3:175843376-175843398 AGAAAGACTTCATCTTTTGATGG + Intergenic
966349746 3:179019697-179019719 AGGGAAAATTTTGCTTTTAATGG + Exonic
967148412 3:186626280-186626302 AGGAAAACGTCAGCTTTTTCTGG + Intergenic
967459511 3:189729057-189729079 AATGAAAATTCTGCTTTTGAAGG + Intronic
967544028 3:190702475-190702497 AGGGAAAACTAAGCTTTAGAAGG - Intergenic
968373530 4:17615-17637 AGGAAAACTACAGCCTTTGTGGG + Intergenic
969861490 4:10039419-10039441 TGGGAAACTACAGGTTTTGTTGG - Intronic
970552572 4:17197363-17197385 TGGGAAACTTCACTTTTTCAGGG + Intergenic
970840005 4:20457221-20457243 AGGGAAATTTCAGCTCTTATGGG + Intronic
976578245 4:86701761-86701783 AAAGAAACTTCAGGTTCTGAGGG + Exonic
976582579 4:86755834-86755856 AGGGTATTTTCAACTTTTGATGG + Intronic
976710707 4:88067935-88067957 AGGGAAACTTCGGCTGCTCATGG - Exonic
978616124 4:110598111-110598133 AGGGAAACTTCATTCATTGAAGG + Intergenic
979094368 4:116527639-116527661 AGGTAACCTTGATCTTTTGATGG + Intergenic
979255711 4:118605585-118605607 AGGGAATCTTCAGCTTAGGTGGG - Intergenic
979378790 4:119983486-119983508 AGGGAATCTTGACTTTTTGATGG - Intergenic
980126082 4:128775694-128775716 AGGGGAACTTCAGCTCTGGAAGG + Intergenic
980305869 4:131060697-131060719 AAAGAAACTTCAACTTTTGTGGG + Intergenic
981332225 4:143524597-143524619 AAATAAACTTCAGATTTTGATGG + Intronic
981366819 4:143913451-143913473 AGGGAAACTTGAGTTACTGAAGG - Intergenic
981376616 4:144023688-144023710 AGGGAAACTTGAGTTACTGAAGG - Intergenic
981387120 4:144145033-144145055 AGGGAAACTTGAGTTACTGAAGG - Intergenic
982781473 4:159495750-159495772 AGGGAAGTGACAGCTTTTGATGG + Intergenic
985461863 4:190114936-190114958 AGGAAAACTACAGCCTTTGTGGG - Intergenic
986081586 5:4400063-4400085 TGGGAAAGTTCAGATTTTGTTGG - Intergenic
986450546 5:7859573-7859595 AGAGGAACCTCAGATTTTGAAGG - Intronic
986512458 5:8522772-8522794 AGGGAAACTACTGCATTTGCTGG - Intergenic
987905926 5:24077250-24077272 AACGTAACTGCAGCTTTTGATGG + Intronic
992621520 5:78598153-78598175 AGGGATACTACAGTTTTTTAAGG + Intronic
996280081 5:121719784-121719806 AAGGAATCTTCAGCTTTTTCAGG + Intergenic
996715534 5:126584858-126584880 AGGGAAACATCAGGTTTTGGGGG + Intronic
998197276 5:140085179-140085201 AGGACAGCTTCAGCTTTTAAGGG - Intergenic
998646049 5:144063552-144063574 AGGTAAATTTCAGCTTTTTCTGG + Intergenic
1000926989 5:167205949-167205971 AGAGAAAGTTCTGCTTTTAAGGG + Intergenic
1001202119 5:169727813-169727835 TTGGAAACTTCTGCTTTTGGCGG + Intronic
1001829248 5:174771704-174771726 AGGGGAAATGCAGCTTTTCATGG + Intergenic
1003332501 6:5141701-5141723 AGGGATTCTAGAGCTTTTGAGGG + Intronic
1004193524 6:13485494-13485516 ATAGAAACTTCAGCTTTCAAAGG + Intronic
1004587335 6:17015408-17015430 AGTGAAACTACAGATTTTTAAGG + Intergenic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008483429 6:52009843-52009865 GTGGAAACTTCAGCTTCTGAGGG - Intronic
1009028553 6:58029271-58029293 AAGAAAACTTCAACTTTTTAAGG + Intergenic
1009938463 6:70261127-70261149 TGGGAACCTACTGCTTTTGATGG - Intronic
1011232763 6:85181349-85181371 ATGGAAACTTCAAGTTTTGAGGG - Intergenic
1011667215 6:89646135-89646157 ATTGAAAATTCAGCATTTGAGGG - Intronic
1013802892 6:113967964-113967986 AGGGAACCTTCAGACATTGATGG - Intronic
1014562759 6:122910969-122910991 AGGGAATTTTCTGCTTTTTAAGG + Intergenic
1015956506 6:138604235-138604257 TGGGAAACTTGAGCTTTGCAAGG - Intronic
1016515811 6:144892177-144892199 AGGGAAAGTGTAGCTTTGGAAGG + Intergenic
1017034704 6:150256798-150256820 ATGGGAAATTCAGCTCTTGAAGG - Intergenic
1017251393 6:152283977-152283999 GGGGAAACGGCAGCTTTTGGAGG - Exonic
1018010657 6:159666996-159667018 AGGGAAACCTAAGCCTTTGGTGG + Intergenic
1018071823 6:160171385-160171407 GGAGAAACATCAGCATTTGATGG + Intronic
1019025575 6:168960050-168960072 AGGGAAAATACAGAGTTTGAAGG - Intergenic
1021889840 7:25176980-25177002 AGAGAATCTTCAGATCTTGAAGG + Intronic
1022059779 7:26781934-26781956 AGGGAAACTTGATCTATTCAGGG - Intronic
1027652337 7:80884586-80884608 AGGGAAACTTCAGCTTTTGAGGG + Intronic
1028550672 7:92060083-92060105 AGAGTAACTACAGCTTTTGATGG - Intronic
1028900689 7:96097369-96097391 AGGGAAACATCTGCTTTGGAGGG + Intronic
1029166437 7:98594800-98594822 AGAGAAGCGTCAGCTTTTCAGGG - Intergenic
1030357657 7:108560332-108560354 AGGGAAACTGCTCCTTTTCAAGG + Intronic
1030536275 7:110771080-110771102 AGGGAAAATTAACCTTTGGAAGG + Intronic
1031548332 7:123077858-123077880 TGGGAAACTTCTGGTTATGACGG + Intergenic
1032750311 7:134833203-134833225 AGTGAAACTTCTGGTTTTGGGGG + Intronic
1033918982 7:146363953-146363975 ATGGAAGGTTCAGCCTTTGATGG + Intronic
1034120663 7:148624441-148624463 GGGAAAACTTTAGCTTTTGGGGG - Intergenic
1035752531 8:2006768-2006790 AGGTAAACTACACCTGTTGAAGG + Exonic
1035862250 8:3041978-3042000 TGGGAAACATCAGCTCTGGAAGG + Intronic
1037262523 8:17024767-17024789 AAGGAAATTTCACCTTTAGAGGG + Intergenic
1037971194 8:23173208-23173230 AGTGAAACTGCAGATTTTCACGG + Intergenic
1038630889 8:29242964-29242986 AGAGAAATTTCAGCTTTGCAAGG - Intronic
1039282311 8:35998889-35998911 GGGGAAACTTCAGCATTTTTAGG + Intergenic
1040955503 8:52975792-52975814 AGGGATCCTTCAGCTCTTGGTGG - Intergenic
1042064743 8:64861986-64862008 AGGACATCTTCAGTTTTTGAAGG + Intergenic
1043032504 8:75154822-75154844 TGTAAAACTTCAGCTTGTGAGGG - Intergenic
1043072227 8:75652882-75652904 AGGGAAACTTGAGTTTGTGGAGG + Intergenic
1043240464 8:77927292-77927314 AGGTAAACTTCATTTTTTGAGGG - Intergenic
1043766117 8:84134495-84134517 AAGGAAACCTCAGCATTTGTGGG - Intergenic
1045172191 8:99683985-99684007 AGGGAAACTTAACCTGATGAAGG - Intronic
1046546586 8:115658998-115659020 AAGAAAACTTGTGCTTTTGAAGG - Intronic
1046607837 8:116390550-116390572 AGGAAAACTTCTACTTGTGAAGG - Intergenic
1049601813 8:143511375-143511397 AGGGAGAGTTCAGATTTTTATGG + Intronic
1050727256 9:8664853-8664875 AGGTACACTTCAGCTTAAGAAGG + Intronic
1051565117 9:18488725-18488747 AGGGAAATTTCAGCCTTGCAGGG - Intronic
1053530917 9:38879811-38879833 GGGGAAACTGCTGTTTTTGAGGG - Intergenic
1054203140 9:62104244-62104266 GGGGAAACTGCTGTTTTTGAGGG - Intergenic
1054635223 9:67484121-67484143 GGGGAAACTGCTGTTTTTGAGGG + Intergenic
1056893025 9:90513875-90513897 AGGATACCTTCAGCTTCTGATGG - Intergenic
1057575204 9:96236914-96236936 AGGAAAACTTGAGCTTTTAGGGG + Intronic
1059880395 9:118683001-118683023 AGAGAGGCTTCACCTTTTGATGG - Intergenic
1060087034 9:120713326-120713348 AGGGAAACTGGAGCTTTGGGAGG + Intronic
1061465041 9:130771606-130771628 ATAAAAACATCAGCTTTTGAAGG - Intronic
1186039575 X:5461129-5461151 AGGGAAACTTCAGAGGGTGAAGG + Intergenic
1186915872 X:14219917-14219939 AGGGAAACATCTACTTTAGAGGG - Intergenic
1188379251 X:29471176-29471198 GGGGGAACTTCAGTATTTGAAGG + Intronic
1190263236 X:48812507-48812529 AAGGAAACTTCAGCTTATCTTGG + Intronic
1193487751 X:82107701-82107723 AGGGATACTTCAGCTGCTGTGGG + Intergenic
1193671179 X:84388852-84388874 AGGGACACTGTGGCTTTTGAAGG + Intronic
1193830968 X:86289125-86289147 AGGGAAACTTCTGCCTTGAAGGG - Intronic
1194387743 X:93278049-93278071 AGGGAACCTACTGCTTTAGAGGG + Intergenic
1194990636 X:100543391-100543413 AGGGAACCTGCAGCTTTGAAGGG + Intergenic
1196114162 X:111981233-111981255 ACTGAAACATCAGCTTTTTAGGG - Intronic
1198391653 X:136181212-136181234 AACGTAACTTCAGCTTTTGCAGG - Intronic
1199088340 X:143660127-143660149 CGGGAAACATGAGCATTTGAGGG + Intergenic
1200244183 X:154514175-154514197 TGGGAAAGTCCAGCTTTTAAGGG - Intronic
1200302510 X:154991887-154991909 AGGGAGACTCCACCTTTTGATGG - Intronic