ID: 1027654981

View in Genome Browser
Species Human (GRCh38)
Location 7:80919233-80919255
Sequence GGGAGCCGCGGGGGCGGACC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 403}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027654961_1027654981 22 Left 1027654961 7:80919188-80919210 CCAGCCGCGAGGCCCCACCCCGA 0: 1
1: 0
2: 3
3: 27
4: 433
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654973_1027654981 -7 Left 1027654973 7:80919217-80919239 CCGCGAGAGCCTGGCAGGGAGCC 0: 1
1: 0
2: 2
3: 21
4: 311
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654962_1027654981 18 Left 1027654962 7:80919192-80919214 CCGCGAGGCCCCACCCCGAGCGC 0: 1
1: 0
2: 1
3: 44
4: 472
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654964_1027654981 9 Left 1027654964 7:80919201-80919223 CCCACCCCGAGCGCGCCCGCGAG 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654965_1027654981 8 Left 1027654965 7:80919202-80919224 CCACCCCGAGCGCGCCCGCGAGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654963_1027654981 10 Left 1027654963 7:80919200-80919222 CCCCACCCCGAGCGCGCCCGCGA 0: 1
1: 0
2: 1
3: 3
4: 113
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654968_1027654981 3 Left 1027654968 7:80919207-80919229 CCGAGCGCGCCCGCGAGAGCCTG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654967_1027654981 4 Left 1027654967 7:80919206-80919228 CCCGAGCGCGCCCGCGAGAGCCT 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654966_1027654981 5 Left 1027654966 7:80919205-80919227 CCCCGAGCGCGCCCGCGAGAGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654960_1027654981 25 Left 1027654960 7:80919185-80919207 CCGCCAGCCGCGAGGCCCCACCC 0: 1
1: 0
2: 1
3: 42
4: 405
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403
1027654972_1027654981 -6 Left 1027654972 7:80919216-80919238 CCCGCGAGAGCCTGGCAGGGAGC 0: 1
1: 0
2: 1
3: 45
4: 387
Right 1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG 0: 1
1: 0
2: 2
3: 29
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027654981 Original CRISPR GGGAGCCGCGGGGGCGGACC GGG Exonic
900374619 1:2347751-2347773 GGGGGCAGCGGGGGCCGAGCAGG - Intronic
900382367 1:2391309-2391331 GGGGGACGCGGGGGCGGCCCTGG + Intronic
900429126 1:2593664-2593686 GGGAGCTGTGGGGGCAGAGCAGG - Intronic
900597946 1:3490941-3490963 GGGAGCCGGAGGGGCCCACCTGG + Exonic
901321507 1:8343089-8343111 GGAAGCCGCAGGGGAGGCCCAGG + Intronic
901489415 1:9589087-9589109 GGGCGGCGCGGGGGCGGGCCTGG - Intronic
901797966 1:11691584-11691606 GGCAGCCCCGGGGCCGGGCCCGG - Exonic
902336785 1:15758736-15758758 GGGAGCCGAGGGGGCGGGGAGGG + Intronic
902371947 1:16012998-16013020 GGGCGCCCAGGGGGCGGAGCCGG + Intergenic
903263445 1:22143171-22143193 GGCGGCCGGGGGGGCGGGCCGGG + Intronic
903291773 1:22318632-22318654 GGAGGCAGAGGGGGCGGACCTGG - Intergenic
903887021 1:26546539-26546561 GGAAGCCCCACGGGCGGACCTGG + Intronic
903950582 1:26993928-26993950 GGCAGCGGCGGGGACTGACCCGG - Exonic
905374986 1:37514324-37514346 GTGAGCCGCGGGGGTGGGCGAGG - Intronic
905847117 1:41242245-41242267 GGGAGGCGCGGGGGAGGGGCCGG - Intergenic
906078413 1:43068406-43068428 GGGGGCGGCGGGGGCGGGCTGGG + Intergenic
907317144 1:53579711-53579733 GGCAGCCGTGGGGGCAGAGCTGG + Intronic
907430244 1:54406959-54406981 GGGAGGCCCGGGGGCGGGGCGGG - Intronic
908132161 1:61083719-61083741 GGGAGCCGGAGCGGCGGCCCGGG + Intronic
911440516 1:97920797-97920819 GGGGGCCGCGGGGGCCTCCCCGG + Intronic
911440570 1:97921040-97921062 CGGCGGCGCGGGGGCGGAGCGGG + Intronic
913186464 1:116373864-116373886 TGCAGCAGCGGGGGCGGCCCCGG + Exonic
913578011 1:120196946-120196968 GGCAGCCGCGGAGGAGGCCCAGG + Intergenic
913630161 1:120701406-120701428 GGCAGCCGCGGAGGAGGCCCAGG - Intergenic
913644711 1:120845048-120845070 TGGAGCCGCGGGGGCTCAGCTGG + Intergenic
914004215 1:143718224-143718246 TGGAGCCGCGGGGGCTCAGCTGG + Intergenic
914082019 1:144418535-144418557 TGGAGCCGCGGGGGCTCAGCTGG - Intergenic
914099085 1:144568294-144568316 TGGAGCCGCGGGGGCTCAGCTGG + Intergenic
914176926 1:145287035-145287057 TGGAGCCGCGGGGGCTCAGCTGG - Intergenic
914200022 1:145476169-145476191 TGGAGCCGCGGGGGCTCAGCTGG + Intergenic
914299902 1:146369370-146369392 TGGAGCCGCGGGGGCTCAGCTGG - Intergenic
914313458 1:146487357-146487379 TGGAGCCGCGGGGGCTCAGCTGG + Intergenic
914479140 1:148049304-148049326 TGGAGCCGCGGGGGCTCAGCTGG + Intergenic
914500892 1:148246024-148246046 TGGAGCCGCGGGGGCCCAGCTGG - Intergenic
914531654 1:148528527-148528549 TGGAGCCGCGGGGGCTCAGCTGG - Intergenic
914559927 1:148808366-148808388 GGCAGCCGCGGAGGAGGCCCAGG + Intronic
914612906 1:149321849-149321871 GGCAGCCGCGGAGGAGGCCCAGG - Intergenic
914636737 1:149559202-149559224 TGGAGCCGCGGGGGCTCAGCTGG + Intergenic
915537819 1:156548144-156548166 GGAAGCCACGGAGGCGGGCCTGG + Exonic
915539694 1:156558196-156558218 GGGAGGCGCGGGGGGGGGGCCGG + Intronic
915564639 1:156706700-156706722 GGGAGCCTCGGGGACAGGCCTGG + Intergenic
916179168 1:162069616-162069638 GGGCAGCGCGGGGGCGGACCCGG + Intergenic
916233346 1:162561658-162561680 GGGGGCCGCGGCGGCGGGGCGGG - Exonic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
918114109 1:181482572-181482594 GGGAGAAGCGGGGGAGGAGCTGG - Intronic
918480750 1:184974391-184974413 GCTAGCAGCGGGCGCGGACCGGG - Exonic
920616373 1:207496409-207496431 GGGAGGCGCCCGGGCGGACGAGG + Intronic
921355569 1:214281457-214281479 GGGAGCCGGGGGCGCCGAGCGGG + Intronic
921708040 1:218346195-218346217 GGGGGCCGCCGAGGCTGACCTGG - Intergenic
922518243 1:226223859-226223881 GGGGGCGGCGGGGCCGGCCCGGG - Exonic
922565968 1:226602047-226602069 GGGAGCCGCTGGGGAGATCCAGG + Exonic
922870499 1:228898545-228898567 GGGAGCCGAGGCTGCTGACCAGG - Intergenic
923684303 1:236143112-236143134 GGCAGCCGCGGGGGCGGGTCCGG + Intronic
924123193 1:240823560-240823582 GCCTGCCGCGGGGGCGCACCAGG + Intronic
1063382850 10:5597114-5597136 GGGAGCCGCTGGGCCAGCCCTGG - Intergenic
1065100378 10:22325594-22325616 GCGCGCCGCGGGGGCGGGGCCGG - Intronic
1065590383 10:27256814-27256836 GGGAGCGGGGGGGGCGGGGCGGG - Intergenic
1065636733 10:27742537-27742559 GGGAGCCGCCGGATCGGGCCAGG + Intronic
1067060782 10:43077001-43077023 GGGCGGGGCGGGGGCGGTCCAGG - Intergenic
1067553868 10:47254202-47254224 GGGAGGCATGGGGGTGGACCCGG + Intergenic
1069851566 10:71408765-71408787 GGGAGCCGCTGTGGAGGGCCTGG + Intronic
1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG + Exonic
1070791126 10:79190078-79190100 GGGAGCTGTGGGGGCTGCCCAGG + Intronic
1072713191 10:97731477-97731499 GAGAGCCCCGAGGGAGGACCTGG + Intergenic
1073099601 10:100999787-100999809 GGGCGCCGCGGAGGCGGAGGCGG + Exonic
1073577681 10:104639875-104639897 GGGAGCCGCGTGGGCTTATCTGG - Intergenic
1074317110 10:112370310-112370332 GGGAGAGGCGTGGGCGGAACCGG + Intergenic
1076035649 10:127196619-127196641 GGGCGGCGCGGGGCCGGGCCGGG + Intronic
1076306164 10:129467078-129467100 GGGGCGCGCGGGGGCGGAGCTGG - Intergenic
1076373892 10:129971318-129971340 GGCAGCCGTGGCGGCGGGCCTGG + Intergenic
1076791747 10:132780551-132780573 GGGAGCCGCGGGTGCTGGCCCGG - Intronic
1077343508 11:2036332-2036354 GGGAGCCTCAGGGCCGGGCCAGG + Intergenic
1077386117 11:2270291-2270313 GGGCGCAGGGGGCGCGGACCTGG + Exonic
1077491501 11:2862921-2862943 GGGGGCGGCGGGCGCGGGCCCGG + Intergenic
1078317433 11:10305010-10305032 GGGAGCGGCGGGGCGGGGCCTGG - Intronic
1078669727 11:13354183-13354205 GGGGGCCGGGGGGGGAGACCCGG - Intronic
1078934264 11:15938297-15938319 GGGAGCCGCGGGGGCTGTAGAGG - Intergenic
1081831917 11:46121556-46121578 GGGAGCGGCGGGGGCGCGCACGG - Intergenic
1083303780 11:61752606-61752628 GGCAAGCGCGGCGGCGGACCGGG + Intergenic
1083609814 11:63999455-63999477 GGGAGGGGCCGGGGCGGACAGGG - Intronic
1083753861 11:64778559-64778581 GGGCACCGCGGGGGCGGGCCGGG + Intronic
1083764874 11:64836894-64836916 GGGAGCGGCTGGGCCGGGCCTGG - Intronic
1083945167 11:65919371-65919393 GGAAACGGCGGGGGCGGAGCGGG + Exonic
1084146189 11:67266555-67266577 CGGAGCCGCGGGCGCCGAGCAGG + Exonic
1084265552 11:68003615-68003637 GGGAGCGGGCGGGGCGGCCCCGG + Intronic
1087138164 11:94740656-94740678 GGGAGCCGCGGGGTGGCACGCGG + Intronic
1087795675 11:102452837-102452859 GGGTGGCGCGGGGGCGGGCTCGG + Exonic
1088223179 11:107591050-107591072 GGGAGCCGGGGGCGCGGGCGCGG - Intergenic
1089687968 11:120169082-120169104 GGGCGCCGAGGGGGCGCAGCCGG + Exonic
1089835032 11:121363086-121363108 GCGAGCCGCCGGGGCGAAGCGGG + Intergenic
1089845101 11:121452233-121452255 GGGAGCGGCGCGCGCGGTCCCGG + Exonic
1091124274 11:133082162-133082184 GGGAGCCGAGGCGGAGGCCCAGG - Intronic
1091367964 11:135037851-135037873 GGGAGGGGCGGGGGCTGAGCAGG - Intergenic
1202826494 11_KI270721v1_random:91521-91543 GGGAGCCTCAGGGCCGGGCCAGG + Intergenic
1091759424 12:3077315-3077337 GGGCGGCCCGGGGGCGGAGCGGG - Intergenic
1092172747 12:6384006-6384028 GAGGGCCGCGGGGCCGGAACCGG - Intronic
1092401207 12:8180516-8180538 AGGTGGCGCGGGGGCGGCCCCGG + Intronic
1093894691 12:24562749-24562771 GGGGGGCGCGGGGGCGGTGCCGG + Intergenic
1094155457 12:27333180-27333202 CGGGGCAGCGGGGGCAGACCTGG - Intronic
1095349203 12:41188915-41188937 TGGGGCCGCGGGCGGGGACCCGG + Exonic
1096435917 12:51591115-51591137 GGTAGGCGCGGGGGCGGGGCGGG + Intronic
1096654445 12:53079620-53079642 GGGCGCCGCTGAGGCGGACAGGG + Intergenic
1096716211 12:53493051-53493073 GGGGGCCGCGGCGGCGGAAGGGG + Intronic
1097035414 12:56120596-56120618 GGGAGCAGCGGTGGAGGCCCTGG + Exonic
1097990256 12:65825585-65825607 GGGAGCCGCGGCGGGCGGCCCGG + Intronic
1099989876 12:89709737-89709759 GGGAGCGGCGGGGGAGGAGGGGG + Intergenic
1101640649 12:106583888-106583910 GGGAGTGGCGGCGGCGAACCCGG + Intronic
1101750841 12:107581304-107581326 GGTAGGCGCGGGGGCGGGCGGGG + Exonic
1103620544 12:122184626-122184648 GGGAGTGGCGGCTGCGGACCAGG - Exonic
1103822821 12:123712309-123712331 GCGGGACGCGGGGGCGGAACCGG + Exonic
1104395212 12:128426693-128426715 GGGAGCTGCGGAGGGGGACAGGG - Intronic
1104987916 12:132607489-132607511 GGGAGCCGAGGGGGAGGCCAAGG - Intronic
1105675299 13:22664716-22664738 GGAGGCCGAGGGGGCGGATCAGG - Intergenic
1105846664 13:24299622-24299644 GGGAGCCTCGGGAGCGAGCCAGG + Intronic
1110318376 13:74134886-74134908 GCGAGCCGCGGGGACGACCCGGG - Intergenic
1110436239 13:75481233-75481255 CGGAGGCGCGGGGGCGGGCTCGG - Intronic
1110705918 13:78602139-78602161 GGGGGCGGCGGCGGCGGCCCGGG - Exonic
1112088209 13:96053535-96053557 CGGAGCCGCCGGGGCGGCGCCGG + Intergenic
1113372153 13:109733791-109733813 GGGAGCCGTGGGGGCGCGCGTGG + Intergenic
1113593749 13:111517876-111517898 GGGAGCCGGGGGGTGGGGCCAGG - Intergenic
1113822114 13:113222045-113222067 GGGAGCAGCGTGGGCAGCCCTGG + Intronic
1113861488 13:113490434-113490456 CGGAGCCGCGAGGGACGACCGGG - Intronic
1113874304 13:113584913-113584935 GGGAGCCGCGGGCGGGAGCCGGG + Intronic
1114626967 14:24136366-24136388 GGGAGCCTGGGGGGCGGGTCGGG - Intronic
1116186608 14:41606973-41606995 GGCCGCGGCCGGGGCGGACCCGG - Intergenic
1117119390 14:52552322-52552344 GGGACCTGCGGGCGGGGACCTGG + Exonic
1117591087 14:57268850-57268872 GGGAGCAGCGCGGGCGGCGCCGG - Exonic
1117978666 14:61321549-61321571 GGAAGGCGCGGGAGCGGACGCGG + Intronic
1118849227 14:69571940-69571962 GGGAGCTGCGGGAGCGGGCCCGG - Exonic
1120229800 14:81829810-81829832 GGGAGACGCGGGGCGGGAACTGG - Intergenic
1122178760 14:99939568-99939590 GGGAGCCGTGGGGGAGGGCGGGG - Intronic
1123004372 14:105314434-105314456 GGGAGCCGCGGGCAAGGGCCGGG - Exonic
1123024983 14:105420165-105420187 GGGGGCCGCGAGGGCGGGCGGGG - Intronic
1123630625 15:22257849-22257871 GGGGGCCGCGGCCGCGGAACGGG - Intergenic
1124110631 15:26781987-26782009 GGGAGAGGCGCGGGCGGAACCGG - Intronic
1125698516 15:41660034-41660056 GGGCGCGGCCGGGGCGGAGCCGG + Intronic
1126113338 15:45187875-45187897 GGGAGCGCTGGGGGCGGCCCGGG - Intronic
1127847021 15:62878920-62878942 GGGACCCACAGGGGCAGACCAGG - Intergenic
1127922471 15:63504424-63504446 GGGCTGGGCGGGGGCGGACCCGG + Intergenic
1128454950 15:67827104-67827126 GGGAGCGGCGGCGGCGGCGCGGG + Intronic
1128547739 15:68579198-68579220 GGGGGCGGCGGCGGCGGCCCGGG - Exonic
1129196900 15:73973749-73973771 GAGAGCCGCGGGCGGGAACCGGG + Intergenic
1129262143 15:74374421-74374443 GGGCGGGGCGGGCGCGGACCCGG + Intergenic
1129933626 15:79431956-79431978 GGGGACCGAGGGGGCGGTCCCGG - Intergenic
1130295920 15:82647213-82647235 GGGAGTCTCGGGGGCGGGGCTGG - Intronic
1130296082 15:82647763-82647785 GGGTACCGCGGCGCCGGACCCGG + Intronic
1130540345 15:84817356-84817378 GGGAGCGGCGGCGGCGGGCAGGG + Exonic
1132600498 16:770663-770685 GGGAGCCGCCTGGGGGGACGGGG + Exonic
1132785906 16:1656893-1656915 GGGAGCCGGGGCGGGGGTCCTGG - Exonic
1132810011 16:1792938-1792960 GGGTGCTGCGGGAGGGGACCGGG + Intronic
1132847998 16:2009496-2009518 GGGCGCCGGGGGCGCGGCCCGGG - Intronic
1132865615 16:2091389-2091411 GGGAGGCGCGGGGTCTGGCCGGG + Intronic
1134149692 16:11796577-11796599 GGGCGCCGCCCGGGAGGACCGGG - Intronic
1136088686 16:27903270-27903292 GGGAGCAACGTGGTCGGACCTGG + Intronic
1136458473 16:30395542-30395564 GGGCGCCGGGGTGGCGGAGCCGG + Exonic
1137787904 16:51152395-51152417 GGCAGCCGGGGGGGAGGTCCGGG - Intergenic
1139528075 16:67528739-67528761 GGGAGCCGCGGGAGCGCAGGGGG + Intronic
1141621677 16:85239641-85239663 GGGAGCCGTGGGGCCCGCCCTGG - Intergenic
1141839779 16:86567205-86567227 GGGAGCGGGAGGGGCGGCCCCGG - Intergenic
1141989431 16:87602079-87602101 GCGAGGCGCGGGGGCGGGCAGGG + Intronic
1142223802 16:88867738-88867760 GGGAGGCGCAAGGGCGGACACGG - Intergenic
1142708398 17:1710272-1710294 GGGCGCCGAGGGGACCGACCCGG - Exonic
1143116487 17:4584453-4584475 CGGGGCCTCGGGGGCGGAGCCGG - Intronic
1143503482 17:7351823-7351845 GGGAGCCGCTGGGAGGGACTCGG + Intergenic
1143584572 17:7844783-7844805 GGGAGCCGCGGGGTCACATCGGG + Intronic
1143590901 17:7885369-7885391 GCGAGCTGCGCGCGCGGACCGGG + Intronic
1143639878 17:8189845-8189867 GGGAGCCGCAGGGGGGCGCCGGG - Exonic
1143830302 17:9645680-9645702 GGGAGCGGCGGCGGCGGGGCCGG - Exonic
1144109933 17:12021279-12021301 GACGGCCGCGGGGGCGGTCCCGG - Intronic
1145765532 17:27456307-27456329 GGGCGGCGCGGGCGCGGTCCGGG + Intergenic
1146142335 17:30378937-30378959 CTGAGCCGCGGGAGCGGAGCCGG + Exonic
1146279985 17:31538559-31538581 GGGAGCCACAGCGGCGGACATGG - Intergenic
1146371044 17:32265869-32265891 GGGAGCGGCGGGGCCGGGGCCGG + Intergenic
1146716288 17:35089308-35089330 GGGAGCGGCCGGGCCGGGCCGGG - Exonic
1147044982 17:37745172-37745194 GAGAGCCGGAGGGGCAGACCTGG + Exonic
1147139714 17:38454143-38454165 GAGAGCCGCGGGGCCGGGGCCGG + Intronic
1147752452 17:42744741-42744763 AGGAGCGGCGGGGGCGGGCTCGG - Intronic
1148323645 17:46771494-46771516 GGGGGCGGCGGGGGCGGGGCGGG + Intronic
1148337459 17:46851400-46851422 GGGAGGGGCGGGGGCGGTCCAGG + Intronic
1149486519 17:57046620-57046642 GGGAGCCGGTGGGCCGGTCCAGG - Intergenic
1149665667 17:58363380-58363402 AGCAGCCGCTGGGGCTGACCTGG - Exonic
1150489018 17:65561710-65561732 GCGTGCGGCGGGGGCGGGCCGGG - Intronic
1152222163 17:79074886-79074908 GCGCGGCGCGGGGGCGGGCCCGG + Intergenic
1152633184 17:81419889-81419911 GGGAGAGGCGGGCGCGGAGCCGG - Intronic
1152719832 17:81918020-81918042 GGGAGCGGCGGCGGCGTACCTGG + Exonic
1152744852 17:82033925-82033947 GGGAGCGGTGGGGGTGGGCCGGG + Exonic
1153052188 18:909447-909469 GGGAGCCTCGGCGGCGGCGCGGG + Exonic
1153238869 18:3013168-3013190 GGAAGCCGAGGGGGCGGGGCCGG + Intronic
1153805290 18:8705256-8705278 GGGAGCGGCGGGGGCGGGCACGG + Intergenic
1154214885 18:12408335-12408357 CGGAGCCGGGGGGGCGGCCGGGG + Intronic
1155928892 18:31685392-31685414 GGGAGCCGCGGAGGAAAACCGGG + Intronic
1160680192 19:408786-408808 GGGAGCCGGGGGGGCGGAGCTGG - Intronic
1160708095 19:539283-539305 GGGAGACGCAGGGGAGGGCCAGG - Intronic
1160708127 19:539366-539388 GGGAGACGCAGGGGAGGGCCAGG - Intronic
1160730515 19:639827-639849 GGGCGCCTCGGGGGCGGGGCCGG - Intergenic
1160788346 19:912139-912161 GGGAGGTGGGGGGACGGACCCGG + Intronic
1160788356 19:912160-912182 GGGAGTGTGGGGGGCGGACCAGG + Intronic
1160844900 19:1161898-1161920 GGGAGCCGCGGGGGGGGGGGGGG + Intronic
1160991836 19:1863310-1863332 GGGGGCGGCGGGGGTGGCCCCGG + Exonic
1161041110 19:2111194-2111216 GGGAGCTGTGGGGGCTGCCCGGG + Intronic
1161233276 19:3186224-3186246 GGGAGCCCCGAGGGTGGGCCGGG - Intronic
1161350081 19:3786421-3786443 GGGGGCCGCGGAGGCGGGGCGGG - Intronic
1161412310 19:4123587-4123609 GGGACCCTCGGGGGAGGACGGGG - Intronic
1161659361 19:5536554-5536576 GAGAGCCGGGAGGGCGTACCTGG + Intergenic
1162743899 19:12788736-12788758 GGGCCCCGCGGGGGCGCAGCGGG - Intronic
1162802419 19:13118670-13118692 GGGAGACGGGGGAGCGGTCCAGG - Intronic
1162929877 19:13952552-13952574 GGGAGCGGCGGCGGCGGCCCCGG + Exonic
1162958812 19:14114267-14114289 GGGAGCCGTGGGGTGGGAGCAGG + Intronic
1163027044 19:14518477-14518499 CGGCGCCGCGGGGGCGGGCGGGG - Intronic
1163112628 19:15170628-15170650 GGGGGTGGCGGGGGCGGAGCTGG - Intronic
1163501773 19:17680402-17680424 GGGAGGCGCGCCGGCGGACAGGG + Intronic
1163672476 19:18637002-18637024 GGGAGCCGCGCGCGCAGGCCCGG - Exonic
1164959276 19:32413726-32413748 GGGAGGAGCGGGGGCGGGCAGGG + Intronic
1165350030 19:35270071-35270093 GGGAGCCCCGGGGGTGGGGCAGG + Intronic
1165916721 19:39265222-39265244 GGCAGCCGCGGGGAGGGACGTGG + Intergenic
1166094538 19:40530698-40530720 GGGCGGCGCGGGGGCGGGCCGGG + Intronic
1166843217 19:45711607-45711629 GGGAGCCGAGGGTCCGGACTGGG - Exonic
1167154498 19:47730012-47730034 GGGACCCGCGGGAACGAACCTGG - Intronic
1167377385 19:49119355-49119377 GGGAGCCGTGGGGGGGGAGGGGG + Intergenic
1167426821 19:49433912-49433934 GGGTGGCGCTGGGGCGGAGCGGG - Intronic
1167613478 19:50518298-50518320 GGCAGCGGCGGGGGCGGCCCTGG - Exonic
1167621696 19:50564365-50564387 GGGAGCCACGGGGAAGGAGCAGG + Intronic
1167643667 19:50694993-50695015 GGGGGTCTCGGGGGCGGCCCCGG - Intronic
1168255063 19:55160685-55160707 GAGAGCCACCGGGGGGGACCTGG - Exonic
1168408162 19:56121307-56121329 GGGAGCGGCGCGGGCGGAAGCGG - Intergenic
925029186 2:636429-636451 CGCAGCCGCGTGGACGGACCCGG - Intergenic
925069625 2:956241-956263 GGGAGGCGCAGGGGCGGGGCGGG - Intronic
926089891 2:10043226-10043248 GGGGGCGGCGGGGGCGGAGGGGG - Intronic
926089901 2:10043244-10043266 GGGGGCGGCGGGGGCGGAGGGGG - Intronic
926154731 2:10447776-10447798 GGGAGCCGTTGGGGAGGCCCTGG - Intronic
927139003 2:20117408-20117430 GGGAGACCCGGGGGCTGAACTGG - Intergenic
928022493 2:27715698-27715720 GGCAGCCGCTGGGGAGGACGCGG - Exonic
928987682 2:37196852-37196874 GGGAGCCGGGGGAGCGGAGGCGG + Intronic
929966759 2:46542627-46542649 GGGCGCCGCGGGAGGGGCCCGGG + Intronic
932766038 2:74470780-74470802 GGAAGCCGAGGGGGCGGATCAGG + Intergenic
933712178 2:85334710-85334732 GAGAGGCGCGGGGGGGAACCGGG - Intergenic
934763842 2:96869739-96869761 GGGAGCCGCGGCGGCGGAGACGG - Intronic
935746599 2:106194423-106194445 CGGAGGGGCGGGGGCGGAGCCGG - Intergenic
938406327 2:131035111-131035133 GGGCGCCGCGGGGCCGCGCCGGG - Intronic
938583538 2:132669132-132669154 GGTCGCCGCGGGGACGGCCCCGG - Intronic
939886466 2:147686608-147686630 GGGAGAGGCGTGGGCGGAACCGG - Intergenic
940145662 2:150542471-150542493 GGGAGAGGCGGGGGGGGGCCGGG + Intergenic
940453883 2:153872457-153872479 GGCAGGGGCGCGGGCGGACCTGG + Intronic
942450911 2:176107614-176107636 GGCAGCAGCGGGGGCGGCCCCGG + Exonic
944433203 2:199659313-199659335 GGGCGCCGCGGGGGCTCGCCTGG - Intergenic
945465877 2:210170864-210170886 GGGAGGGGTGGGGGCGGACCTGG - Intronic
945649284 2:212538686-212538708 TGGACCCGCGGGCGCGGACTCGG - Exonic
947636079 2:231681277-231681299 GGAAGCCGCAGGGCCGGAGCGGG - Intergenic
947774518 2:232697254-232697276 GGAAGGGGCGGGGGCGGAGCAGG + Intergenic
948402050 2:237691860-237691882 GGGAGGGGCGGGGCAGGACCAGG + Intronic
948684266 2:239660178-239660200 GGGAGGGGCGGGGGAGGACCAGG - Intergenic
948767849 2:240232817-240232839 GGGAGCCCTGGGGGCAGAGCCGG - Intergenic
948945734 2:241218041-241218063 GGGGGCGGCGGGGGCGGGCAGGG + Intronic
1169118674 20:3082954-3082976 GTGCGCGGCGGGGGCGGGCCTGG - Intronic
1171010909 20:21508990-21509012 GGGAGCCCGGGAGGTGGACCCGG - Intergenic
1173251617 20:41366724-41366746 GGGACCCTCGGGGCGGGACCCGG - Exonic
1174317449 20:49713722-49713744 GGGAGCTGCGGGAGCAGGCCCGG - Exonic
1174362678 20:50038755-50038777 GGGAGCCGAGGGGGTGGGGCAGG + Intergenic
1174607105 20:51768695-51768717 GGGGGGCGCGGGCGCGGGCCGGG - Intergenic
1174804425 20:53593672-53593694 GGGCGCCTCGGGGGCGGCGCGGG + Intronic
1174873365 20:54204071-54204093 GGGAGCTGCTGGGGTGGAGCAGG - Intergenic
1175424404 20:58854665-58854687 GGGAGCCTCAGGGGCCGCCCCGG - Exonic
1175598835 20:60256439-60256461 GGGAGCAGTGGAGGAGGACCTGG + Intergenic
1175749216 20:61483677-61483699 GGGGGCAGCGGGGGCGGGGCGGG - Intronic
1175851877 20:62098048-62098070 GGGAGCCCAGGGTGGGGACCTGG + Intergenic
1175887917 20:62302828-62302850 CGCCGGCGCGGGGGCGGACCGGG + Intronic
1175927036 20:62476039-62476061 CGGCGCGGCGGGGGCGGGCCGGG - Intergenic
1176077158 20:63253836-63253858 GGGGGCGGCGGGGGCGGGCGGGG + Intronic
1176131659 20:63498984-63499006 GGGACCCCCGGGGCCGGTCCTGG - Intronic
1176151615 20:63594359-63594381 TGGAGCCGCTGGGGAGGCCCTGG + Intronic
1176194562 20:63831274-63831296 GGGGGCCGCGGGGTTGGAGCGGG - Intergenic
1176201992 20:63865306-63865328 GGGAGCCGAGCGGGCGGCGCCGG - Exonic
1176374999 21:6082697-6082719 GGGAGTCCCTGGGGGGGACCAGG - Intergenic
1176550187 21:8217412-8217434 CGCGGCCCCGGGGGCGGACCCGG - Intergenic
1176569115 21:8400450-8400472 CGCGGCCCCGGGGGCGGACCCGG - Intergenic
1176577029 21:8444682-8444704 CGCGGCCCCGGGGGCGGACCCGG - Intergenic
1176733554 21:10522106-10522128 GGGCGCCTCGGGGGCGGCGCGGG - Intronic
1176952760 21:15065330-15065352 GGGAGCCCGGGGGACGGCCCGGG - Intergenic
1179511954 21:41879194-41879216 GGGGGCAGCGGGTGCGGCCCGGG + Intronic
1179748476 21:43455548-43455570 GGGAGTCCCTGGGGGGGACCAGG + Intergenic
1179882213 21:44297605-44297627 GGCTGCGGCGGGGGCGCACCTGG + Intronic
1180045032 21:45301353-45301375 GGGAGCCTCAGGGGCGGCCGGGG - Intergenic
1180095856 21:45555152-45555174 GGGGGCGGCGGGGGCGGCGCAGG + Intergenic
1180095871 21:45555185-45555207 GGGGGCGGCGGGGGCGGCGCAGG + Intergenic
1180151042 21:45948072-45948094 GTGAGGTGCGGCGGCGGACCCGG - Intergenic
1181312411 22:21952514-21952536 GGGAGCCAAGGGGGCAGAACTGG - Intronic
1181514342 22:23402612-23402634 GGGCGGGCCGGGGGCGGACCCGG + Intergenic
1183535449 22:38398355-38398377 GGGCGCCTCGGGGGCGGCGCGGG + Intronic
1183665517 22:39243971-39243993 GGGCCCCGCGGGGCCGGGCCCGG - Exonic
1184245508 22:43233890-43233912 GGGAGCCTCGGGGAGGGACATGG + Intronic
1184523112 22:45007446-45007468 GGGGCGCGCGGGGGCGGGCCCGG + Intronic
1184557452 22:45240953-45240975 GGAAGGGGCGGGGCCGGACCGGG - Intergenic
1184766875 22:46576877-46576899 GCGAGCGGCGGGGGCGCACGTGG + Intronic
1185063332 22:48618543-48618565 CGGAGCTGCGGGTGCGGACGAGG - Intronic
1185119498 22:48957579-48957601 GGGAGCCGCAGGGACAGGCCTGG + Intergenic
1185281346 22:49971379-49971401 GGGAGCGGCGCAGGCGGAGCCGG + Intergenic
1185336202 22:50271864-50271886 GGGAGGCGCAGGGGCGGGGCCGG - Intergenic
1185349550 22:50327299-50327321 GGGAGCCTCGGGGCCAGGCCAGG + Intergenic
1203255082 22_KI270733v1_random:133750-133772 CGCGGCCCCGGGGGCGGACCCGG - Intergenic
1203263138 22_KI270733v1_random:178829-178851 CGCGGCCCCGGGGGCGGACCCGG - Intergenic
950044041 3:9938405-9938427 GGGAGGGGCGGGTGCTGACCTGG + Intronic
950487811 3:13283121-13283143 GGGGGCCCCGGGGGCGGCGCCGG - Intergenic
951717495 3:25664642-25664664 GCGAGCCGCGAGGGCGGCCGGGG + Intronic
952851936 3:37736675-37736697 GAGAGCCTCGGTGGCGGAACAGG + Intronic
956678025 3:71753677-71753699 GGCAGCGGCGGCGGCGGGCCCGG + Intronic
957079371 3:75623522-75623544 GGGAGCGGGGGGGGCGGGGCAGG - Intergenic
960224016 3:115148098-115148120 GGGAGCCGCGGGAGCGGAGAGGG + Intergenic
960960388 3:123066920-123066942 GGGGGCTGCGGGTGCGGACTGGG - Intergenic
961359426 3:126357567-126357589 GGGAGCCGCGCGGGCGGGCCGGG - Intergenic
963939398 3:151085258-151085280 CGGAGCCGCGGAGGCGGGCTCGG - Intergenic
966182152 3:177197358-177197380 GGGAGGGGCGGGGGCGCACGCGG + Intronic
967133465 3:186493891-186493913 GGGGACCGGGGGGACGGACCTGG - Intergenic
967867734 3:194204148-194204170 GGCAGCCGCGGGGGCGGCGCTGG + Intergenic
967877616 3:194277631-194277653 GGGAGCCTTTGGGGAGGACCTGG - Intergenic
968173475 3:196528902-196528924 GGGGGCCGCGGGAGTGGAGCCGG + Intergenic
968459669 4:718261-718283 GGTAGCCCCGGGGGCGGCGCTGG + Intronic
968548367 4:1210080-1210102 GGCTGCCGTGGGGGCTGACCAGG + Intergenic
968585669 4:1414886-1414908 GGCAGCTGCGGGGGCGGTGCAGG - Intergenic
968674661 4:1871187-1871209 GGGGGCCGCGCGGGCGGGCGGGG - Intergenic
968674728 4:1871372-1871394 GGGAGGCGCGGGGGCGGGGTCGG + Intergenic
968879943 4:3293427-3293449 GGGACCCGCGGGGGCGGCGCCGG + Intronic
970585705 4:17512163-17512185 GGCAGCAGCGGGCGCGGAGCGGG - Exonic
972396658 4:38664107-38664129 GGGAGCCGCCGCGGCCGCCCGGG - Intergenic
975985882 4:80201576-80201598 GGGAGCGGCAGGGGCTCACCCGG + Intronic
980941640 4:139280272-139280294 GGGGGCCGCGGAGGCGGGGCTGG - Exonic
982257659 4:153466303-153466325 GGGCGGCACGGGGGCGGGCCCGG + Intergenic
985476064 5:79982-80004 GACATCCGCGGGGGCGGCCCAGG + Intergenic
985512057 5:318592-318614 GGGAGCCGCTTGGGCAGCCCTGG - Intronic
985830762 5:2227692-2227714 GGGAGCCGTTAGGGCTGACCTGG - Intergenic
986151121 5:5131283-5131305 GGGAGCCCAGTGGGCTGACCAGG - Intergenic
986249638 5:6044500-6044522 GGGAGCCGCAGGGGAGGAGGTGG + Intergenic
986721472 5:10563962-10563984 GGGGGACGCCGGGGCGGAGCCGG - Intergenic
988949546 5:36242473-36242495 GGGGGCTGAGGAGGCGGACCCGG + Intergenic
992627586 5:78648945-78648967 GGGCGGCGGGCGGGCGGACCAGG + Intronic
997653008 5:135536026-135536048 GGCTGCCGCGGGGGCGGAGGTGG - Intergenic
998583560 5:143403967-143403989 GGCAGCGGCGGGGGCCGACCTGG + Intronic
998849353 5:146338882-146338904 GGGACTCGCAGGGGCGGCCCGGG - Intronic
1002200333 5:177524385-177524407 GGGAGCCGGGGGAGCCGGCCAGG - Exonic
1002632628 5:180591338-180591360 GGCAGCGGCGGGGGCGCAGCGGG + Intronic
1003284886 6:4725666-4725688 GGGAGAGGCGCGGGCGGAACCGG - Intronic
1005847401 6:29792473-29792495 GGGATCCGCGCGGCCGGGCCGGG - Intergenic
1006181057 6:32153771-32153793 GGGCGGCCAGGGGGCGGACCAGG - Intronic
1006336989 6:33425990-33426012 GGGAGCGGCGGGAGCTGGCCGGG + Intronic
1006614665 6:35318254-35318276 GGGAGCAGCGGGAGCGGCGCCGG + Exonic
1007623511 6:43229214-43229236 CGGGGACGCGGGCGCGGACCTGG - Intronic
1007784221 6:44270838-44270860 GGCAGCGGCGGCGGCGGACGAGG + Exonic
1014517732 6:122399998-122400020 GGGAGCCGCGGGGGCCCGGCCGG + Intronic
1015024899 6:128520618-128520640 GGGAGGGACGGGGGCGGAGCCGG + Intronic
1015149109 6:130019312-130019334 GGGGGGCGCGGGGGCGGCCGGGG + Intronic
1015626023 6:135181543-135181565 GGGAGCCGGGCGGGCGGCCGAGG + Intronic
1017737730 6:157380312-157380334 AGGAGCTGCGGGCGCGGCCCTGG - Intergenic
1017899286 6:158705556-158705578 TAGAGCAGCGGGGGGGGACCTGG + Intronic
1018628718 6:165804759-165804781 GGGAGCGGCGGCGGGGGACTGGG + Intronic
1018876568 6:167827008-167827030 GGCAGCCGCGGAGGCGGAGGCGG + Exonic
1018909420 6:168093482-168093504 GGGAGCCCCGGGCTCGGTCCAGG - Intergenic
1019711470 7:2519999-2520021 GGGCCCCGCGGGGGCTGCCCCGG + Exonic
1020552310 7:9621804-9621826 GAGAGCCGCGGGCGGGAACCAGG - Intergenic
1021450338 7:20778273-20778295 GGGAGCGGCGGGCCCGGGCCGGG + Intergenic
1022517791 7:30986987-30987009 GGGAGCGGCTGGGGCAGCCCAGG + Intronic
1026665543 7:72337184-72337206 GGGATCCGCTGGGGAGGAGCTGG - Intronic
1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG + Exonic
1029098348 7:98106998-98107020 TGGAGCGGCAGGTGCGGACCGGG + Exonic
1029259691 7:99293460-99293482 GGGAGCCTTGGGGGAGGACCAGG - Intergenic
1029419618 7:100466094-100466116 GGGAGCCACGGCGGCTGGCCAGG + Intronic
1032011573 7:128351187-128351209 GGGAGCTCCGGGGGCGCAGCGGG + Exonic
1032037367 7:128530879-128530901 GGGGGCCGCCGAGGCGGATCCGG + Intergenic
1032125234 7:129188738-129188760 GGCTGGCGCGGGGGCGGAGCCGG + Intergenic
1033159142 7:138981383-138981405 CGGAGAGGCGGGGGCGGGCCGGG + Intergenic
1033220507 7:139523989-139524011 GGGGGCGGCGGGGGCGGGCGCGG - Exonic
1034284115 7:149873458-149873480 GCGAGCGGCGGGCGCGGACCGGG - Exonic
1035463603 7:159061813-159061835 GCGAGCCGCGGCGGAGTACCGGG + Intronic
1036276346 8:7355025-7355047 AGGTGGCGCGGGGGCGGCCCCGG - Intergenic
1036344998 8:7955322-7955344 AGGTGGCGCGGGGGCGGCCCCGG + Intergenic
1036708078 8:11059736-11059758 GGGAGCCGCGGGGCGGGGTCCGG - Intronic
1036789518 8:11708720-11708742 CGGAGCGGCGGGTGCGGGCCTGG + Exonic
1036840333 8:12116089-12116111 AGGTGGCGCGGGGGCGGCCCTGG + Intergenic
1036862124 8:12362326-12362348 AGGTGGCGCGGGGGCGGCCCCGG + Intergenic
1038304120 8:26383532-26383554 GGGCGGGGCGGGGGCGGGCCTGG + Intronic
1038633002 8:29263124-29263146 CGGAGCCGGGGGTGGGGACCGGG + Intronic
1041690236 8:60679926-60679948 GGGAGCCGCCGGGGAGCCCCAGG - Intronic
1047676187 8:127205772-127205794 GGGGGCCGGGGGGGCGGTGCAGG + Intergenic
1047951555 8:129939691-129939713 GGGAGCCCCGGGTCCGGAGCGGG + Exonic
1049457517 8:142701008-142701030 GGGAGTCGGGGGGCAGGACCTGG + Intronic
1049613694 8:143567355-143567377 GGGGCCCGCGGGGGCAGCCCCGG + Exonic
1049762455 8:144337393-144337415 GGGATCTGCGGGGGCGGGCGGGG + Intergenic
1049828639 8:144685890-144685912 GACCGCCGCGGGGGCGGAGCCGG - Intergenic
1052807497 9:33025651-33025673 GGGGGCCGCGGGGGCGCGCACGG - Intronic
1053138275 9:35665239-35665261 GGGAGCCGCGGAGGCGGGGCCGG + Exonic
1053311842 9:37025427-37025449 GGGAGCGGGGTGGGAGGACCAGG + Intronic
1054579782 9:66900813-66900835 GGGAGCCGAGGCTGCGCACCTGG + Exonic
1056475304 9:86946830-86946852 GGGAGCGGCGGACGCGGAGCCGG + Exonic
1056478766 9:86979846-86979868 GGGAGCAGCAGGGAAGGACCTGG - Intergenic
1057035881 9:91811376-91811398 GAGAAGCGCTGGGGCGGACCTGG - Intronic
1057488653 9:95506158-95506180 GAGAGCGGCGGGGGCGGGACGGG - Intronic
1057489659 9:95511175-95511197 GGGAGCCGCGTGGACCGCCCCGG - Intronic
1057758055 9:97853023-97853045 GGGTGCGGAGGGGGCCGACCCGG + Intergenic
1058235722 9:102487299-102487321 GGGAGAGGCGCGGGCGGAACCGG - Intergenic
1058861291 9:109119843-109119865 GGGACCCGCGGCGCCGGCCCGGG + Exonic
1058866656 9:109167183-109167205 GGGCGCCGCGGGCGCGGGCCGGG + Exonic
1060300256 9:122370964-122370986 GGGAGGAGCGGGGGTGGAGCCGG + Intronic
1060593569 9:124834638-124834660 GGGAGCCACAGGAGAGGACCAGG + Intergenic
1060658328 9:125388042-125388064 GGGAGCCTCTGGGGTGGGCCTGG + Intergenic
1060770150 9:126326737-126326759 GCGGGCCGCGGCGGCGGGCCGGG - Intergenic
1060855858 9:126914819-126914841 GGCAGACGCGGGAGCGGAGCCGG - Exonic
1060934905 9:127509142-127509164 CGGGGCCGCGGGGGCTGAGCAGG + Intronic
1060979861 9:127785825-127785847 GGGAGCCGGGGCGCCGGAGCTGG - Intronic
1061317194 9:129803551-129803573 GGGAGCGGATGGGGCGGCCCCGG + Intronic
1061584332 9:131556213-131556235 GGTAGGTGCGGGGGCGGCCCTGG + Intergenic
1061836357 9:133332563-133332585 CGGAGCCGCGGGAGCCGCCCGGG - Exonic
1062133698 9:134913665-134913687 GGGAGCCACTGGGGCTGACCAGG - Intronic
1062347001 9:136119446-136119468 GGGCGGCGGGGGGGCGGCCCTGG - Intergenic
1062372926 9:136249394-136249416 GGGAGCCCCGGGGCAGGGCCAGG + Intergenic
1062528034 9:136986065-136986087 GGCAGCCGCTTGGGAGGACCCGG - Intronic
1062555772 9:137112848-137112870 GGGAGCCAGGGAGGCGGAGCTGG - Intronic
1062574551 9:137200190-137200212 GGGGGCCGCGGGCGGGGGCCGGG + Exonic
1062582309 9:137234059-137234081 GGGAGCCTGGGGGGTGGGCCGGG - Intronic
1062591941 9:137278260-137278282 GGGAGCCGCGGGCGGGGGCAGGG + Intronic
1062597150 9:137304546-137304568 GGGAGCCACGGTGGAGGAGCAGG - Intergenic
1203731859 Un_GL000216v2:98761-98783 TCGAGCCGGGTGGGCGGACCCGG - Intergenic
1203471480 Un_GL000220v1:116887-116909 CGCGGCCCCGGGGGCGGACCCGG - Intergenic
1203479301 Un_GL000220v1:160859-160881 CGCGGCCCCGGGGGCGGACCCGG - Intergenic
1185508246 X:644373-644395 TGGACCTGCGGGAGCGGACCCGG - Exonic
1186410780 X:9342828-9342850 GAGATCCCCGGGGGAGGACCCGG - Intergenic
1186425980 X:9464874-9464896 AGGAGCCGCGGGGGAGGGGCAGG + Intronic
1187403656 X:18984140-18984162 GGGAGGCGCGGGGGCGGGGACGG + Exonic
1187826082 X:23334477-23334499 ACGAGCCGCGGGGGCTGCCCCGG + Exonic
1189002873 X:36963964-36963986 GGGAGCCGCGGGCGGGGGCCTGG - Intergenic
1189262662 X:39689265-39689287 CGGGGACGCGGGGGCGGCCCGGG - Intergenic
1189512447 X:41676560-41676582 GGGCGCCGCTGGGCCGGGCCTGG + Intronic
1190745904 X:53321467-53321489 GGGGCGCGCGGGGGCGGGCCGGG - Intergenic
1192727617 X:73768998-73769020 GGGTGCTGCGGGGGCTCACCTGG - Intergenic
1196731612 X:118946637-118946659 GGGAGCGGGTGGGGCGGATCTGG + Intergenic
1197774457 X:130110515-130110537 GGCGGCCGCGGGGACCGACCGGG - Intronic
1198682193 X:139194860-139194882 GGGAACCGCGGGCCCGGGCCAGG - Intronic
1200119361 X:153783188-153783210 GGGAGCGGTGGGGGGGGACAGGG - Intronic