ID: 1027655385

View in Genome Browser
Species Human (GRCh38)
Location 7:80923957-80923979
Sequence GCATTTAATAACTTTAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027655383_1027655385 -1 Left 1027655383 7:80923935-80923957 CCATGTGTTCTCATTATTTGTGG No data
Right 1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG No data
1027655378_1027655385 28 Left 1027655378 7:80923906-80923928 CCCAGTGTGTGTTGTTCCCCTCT 0: 609
1: 2115
2: 5767
3: 11576
4: 21478
Right 1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG No data
1027655381_1027655385 11 Left 1027655381 7:80923923-80923945 CCCTCTATGTGTCCATGTGTTCT 0: 726
1: 2029
2: 8390
3: 18661
4: 18665
Right 1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG No data
1027655377_1027655385 29 Left 1027655377 7:80923905-80923927 CCCCAGTGTGTGTTGTTCCCCTC 0: 1202
1: 4004
2: 9165
3: 18281
4: 15886
Right 1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG No data
1027655382_1027655385 10 Left 1027655382 7:80923924-80923946 CCTCTATGTGTCCATGTGTTCTC 0: 711
1: 2173
2: 8197
3: 18910
4: 15611
Right 1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG No data
1027655379_1027655385 27 Left 1027655379 7:80923907-80923929 CCAGTGTGTGTTGTTCCCCTCTA 0: 436
1: 1094
2: 2513
3: 6374
4: 13691
Right 1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG No data
1027655380_1027655385 12 Left 1027655380 7:80923922-80923944 CCCCTCTATGTGTCCATGTGTTC 0: 607
1: 1749
2: 7383
3: 17723
4: 17818
Right 1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027655385 Original CRISPR GCATTTAATAACTTTAAAGA AGG Intergenic
No off target data available for this crispr