ID: 1027662737

View in Genome Browser
Species Human (GRCh38)
Location 7:81006481-81006503
Sequence GTTCCCAGTGCATTTTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027662737_1027662738 -4 Left 1027662737 7:81006481-81006503 CCTCACAAAAATGCACTGGGAAC No data
Right 1027662738 7:81006500-81006522 GAACCATGAGCATCGCAATTTGG No data
1027662737_1027662743 28 Left 1027662737 7:81006481-81006503 CCTCACAAAAATGCACTGGGAAC No data
Right 1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG No data
1027662737_1027662741 9 Left 1027662737 7:81006481-81006503 CCTCACAAAAATGCACTGGGAAC No data
Right 1027662741 7:81006513-81006535 CGCAATTTGGAAAACTGGACTGG No data
1027662737_1027662740 4 Left 1027662737 7:81006481-81006503 CCTCACAAAAATGCACTGGGAAC No data
Right 1027662740 7:81006508-81006530 AGCATCGCAATTTGGAAAACTGG No data
1027662737_1027662742 18 Left 1027662737 7:81006481-81006503 CCTCACAAAAATGCACTGGGAAC No data
Right 1027662742 7:81006522-81006544 GAAAACTGGACTGGCTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027662737 Original CRISPR GTTCCCAGTGCATTTTTGTG AGG (reversed) Intergenic
No off target data available for this crispr