ID: 1027662739

View in Genome Browser
Species Human (GRCh38)
Location 7:81006503-81006525
Sequence TTTCCAAATTGCGATGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027662739_1027662743 6 Left 1027662739 7:81006503-81006525 CCATGAGCATCGCAATTTGGAAA No data
Right 1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG No data
1027662739_1027662742 -4 Left 1027662739 7:81006503-81006525 CCATGAGCATCGCAATTTGGAAA No data
Right 1027662742 7:81006522-81006544 GAAAACTGGACTGGCTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027662739 Original CRISPR TTTCCAAATTGCGATGCTCA TGG (reversed) Intergenic
No off target data available for this crispr