ID: 1027662739 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:81006503-81006525 |
| Sequence | TTTCCAAATTGCGATGCTCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1027662739_1027662743 | 6 | Left | 1027662739 | 7:81006503-81006525 | CCATGAGCATCGCAATTTGGAAA | No data | ||
| Right | 1027662743 | 7:81006532-81006554 | CTGGCTACACAGGTCCAACTCGG | No data | ||||
| 1027662739_1027662742 | -4 | Left | 1027662739 | 7:81006503-81006525 | CCATGAGCATCGCAATTTGGAAA | No data | ||
| Right | 1027662742 | 7:81006522-81006544 | GAAAACTGGACTGGCTACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1027662739 | Original CRISPR | TTTCCAAATTGCGATGCTCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||