ID: 1027662743

View in Genome Browser
Species Human (GRCh38)
Location 7:81006532-81006554
Sequence CTGGCTACACAGGTCCAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027662739_1027662743 6 Left 1027662739 7:81006503-81006525 CCATGAGCATCGCAATTTGGAAA No data
Right 1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG No data
1027662737_1027662743 28 Left 1027662737 7:81006481-81006503 CCTCACAAAAATGCACTGGGAAC No data
Right 1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027662743 Original CRISPR CTGGCTACACAGGTCCAACT CGG Intergenic
No off target data available for this crispr