ID: 1027670580

View in Genome Browser
Species Human (GRCh38)
Location 7:81091809-81091831
Sequence TACAGGTGTGATCCACCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027670577_1027670580 -2 Left 1027670577 7:81091788-81091810 CCTCGGCCAAAGTGCTGGGATTA 0: 17
1: 70
2: 379
3: 545
4: 725
Right 1027670580 7:81091809-81091831 TACAGGTGTGATCCACCGCACGG No data
1027670574_1027670580 2 Left 1027670574 7:81091784-81091806 CCCACCTCGGCCAAAGTGCTGGG No data
Right 1027670580 7:81091809-81091831 TACAGGTGTGATCCACCGCACGG No data
1027670570_1027670580 25 Left 1027670570 7:81091761-81091783 CCATCTCTTGACCTCATGATCTG 0: 90
1: 623
2: 1831
3: 3409
4: 3256
Right 1027670580 7:81091809-81091831 TACAGGTGTGATCCACCGCACGG No data
1027670576_1027670580 1 Left 1027670576 7:81091785-81091807 CCACCTCGGCCAAAGTGCTGGGA 0: 11
1: 33
2: 63
3: 209
4: 2305
Right 1027670580 7:81091809-81091831 TACAGGTGTGATCCACCGCACGG No data
1027670572_1027670580 14 Left 1027670572 7:81091772-81091794 CCTCATGATCTGCCCACCTCGGC 0: 916
1: 7087
2: 23773
3: 53476
4: 59829
Right 1027670580 7:81091809-81091831 TACAGGTGTGATCCACCGCACGG No data
1027670579_1027670580 -8 Left 1027670579 7:81091794-81091816 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1027670580 7:81091809-81091831 TACAGGTGTGATCCACCGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027670580 Original CRISPR TACAGGTGTGATCCACCGCA CGG Intergenic
No off target data available for this crispr