ID: 1027680274

View in Genome Browser
Species Human (GRCh38)
Location 7:81211744-81211766
Sequence CTCACTCCTAGAACCTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027680274_1027680276 18 Left 1027680274 7:81211744-81211766 CCTCAATAGGTTCTAGGAGTGAG No data
Right 1027680276 7:81211785-81211807 CCACATGTATTGCACATGAGTGG No data
1027680274_1027680277 27 Left 1027680274 7:81211744-81211766 CCTCAATAGGTTCTAGGAGTGAG No data
Right 1027680277 7:81211794-81211816 TTGCACATGAGTGGCACAGTCGG No data
1027680274_1027680278 28 Left 1027680274 7:81211744-81211766 CCTCAATAGGTTCTAGGAGTGAG No data
Right 1027680278 7:81211795-81211817 TGCACATGAGTGGCACAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027680274 Original CRISPR CTCACTCCTAGAACCTATTG AGG (reversed) Intergenic
No off target data available for this crispr