ID: 1027680276

View in Genome Browser
Species Human (GRCh38)
Location 7:81211785-81211807
Sequence CCACATGTATTGCACATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027680272_1027680276 26 Left 1027680272 7:81211736-81211758 CCTGTAAACCTCAATAGGTTCTA No data
Right 1027680276 7:81211785-81211807 CCACATGTATTGCACATGAGTGG No data
1027680274_1027680276 18 Left 1027680274 7:81211744-81211766 CCTCAATAGGTTCTAGGAGTGAG No data
Right 1027680276 7:81211785-81211807 CCACATGTATTGCACATGAGTGG No data
1027680271_1027680276 27 Left 1027680271 7:81211735-81211757 CCCTGTAAACCTCAATAGGTTCT No data
Right 1027680276 7:81211785-81211807 CCACATGTATTGCACATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027680276 Original CRISPR CCACATGTATTGCACATGAG TGG Intergenic
No off target data available for this crispr