ID: 1027682285

View in Genome Browser
Species Human (GRCh38)
Location 7:81235890-81235912
Sequence GTTCCAATGGGGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027682285_1027682292 1 Left 1027682285 7:81235890-81235912 CCTTCCACTTTCCCCATTGGAAC No data
Right 1027682292 7:81235914-81235936 CATGCTGTCTCATCTAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027682285 Original CRISPR GTTCCAATGGGGAAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr