ID: 1027685793

View in Genome Browser
Species Human (GRCh38)
Location 7:81277926-81277948
Sequence AGTTATCTGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027685793_1027685796 4 Left 1027685793 7:81277926-81277948 CCTGCCATTTTCTGCAGATAACT No data
Right 1027685796 7:81277953-81277975 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1027685793_1027685799 16 Left 1027685793 7:81277926-81277948 CCTGCCATTTTCTGCAGATAACT No data
Right 1027685799 7:81277965-81277987 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1027685793_1027685800 22 Left 1027685793 7:81277926-81277948 CCTGCCATTTTCTGCAGATAACT No data
Right 1027685800 7:81277971-81277993 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1027685793_1027685798 15 Left 1027685793 7:81277926-81277948 CCTGCCATTTTCTGCAGATAACT No data
Right 1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027685793 Original CRISPR AGTTATCTGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr