ID: 1027690064

View in Genome Browser
Species Human (GRCh38)
Location 7:81333757-81333779
Sequence CAGGCGTGAGGTCCGCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027690061_1027690064 -3 Left 1027690061 7:81333737-81333759 CCGTAGTTGGATCTCGGGAGCAG No data
Right 1027690064 7:81333757-81333779 CAGGCGTGAGGTCCGCTGCGAGG No data
1027690060_1027690064 -2 Left 1027690060 7:81333736-81333758 CCCGTAGTTGGATCTCGGGAGCA No data
Right 1027690064 7:81333757-81333779 CAGGCGTGAGGTCCGCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027690064 Original CRISPR CAGGCGTGAGGTCCGCTGCG AGG Intergenic
No off target data available for this crispr