ID: 1027691563

View in Genome Browser
Species Human (GRCh38)
Location 7:81353377-81353399
Sequence AAGAAGCCCGAAGAACATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027691563_1027691566 11 Left 1027691563 7:81353377-81353399 CCCAGATGTTCTTCGGGCTTCTT No data
Right 1027691566 7:81353411-81353433 TCTAGATCACTAGCAAGATCAGG No data
1027691563_1027691567 12 Left 1027691563 7:81353377-81353399 CCCAGATGTTCTTCGGGCTTCTT No data
Right 1027691567 7:81353412-81353434 CTAGATCACTAGCAAGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027691563 Original CRISPR AAGAAGCCCGAAGAACATCT GGG (reversed) Intergenic