ID: 1027691563 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:81353377-81353399 |
Sequence | AAGAAGCCCGAAGAACATCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1027691563_1027691566 | 11 | Left | 1027691563 | 7:81353377-81353399 | CCCAGATGTTCTTCGGGCTTCTT | No data | ||
Right | 1027691566 | 7:81353411-81353433 | TCTAGATCACTAGCAAGATCAGG | 0: 1 1: 2 2: 45 3: 263 4: 634 |
||||
1027691563_1027691567 | 12 | Left | 1027691563 | 7:81353377-81353399 | CCCAGATGTTCTTCGGGCTTCTT | No data | ||
Right | 1027691567 | 7:81353412-81353434 | CTAGATCACTAGCAAGATCAGGG | 0: 1 1: 4 2: 38 3: 234 4: 511 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1027691563 | Original CRISPR | AAGAAGCCCGAAGAACATCT GGG (reversed) | Intergenic | ||